Incidental Mutation 'R4837:Tedc2'
ID374371
Institutional Source Beutler Lab
Gene Symbol Tedc2
Ensembl Gene ENSMUSG00000024118
Gene Nametubulin epsilon and delta complex 2
Synonyms1600002H07Rik
MMRRC Submission 042452-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.839) question?
Stock #R4837 (G1)
Quality Score220
Status Validated
Chromosome17
Chromosomal Location24215054-24220851 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 24220593 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 25 (A25S)
Ref Sequence ENSEMBL: ENSMUSP00000024930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024930] [ENSMUST00000115390]
Predicted Effect probably damaging
Transcript: ENSMUST00000024930
AA Change: A25S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024930
Gene: ENSMUSG00000024118
AA Change: A25S

DomainStartEndE-ValueType
low complexity region 32 49 N/A INTRINSIC
low complexity region 78 84 N/A INTRINSIC
low complexity region 111 131 N/A INTRINSIC
Pfam:DUF4693 150 434 8.6e-145 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115390
SMART Domains Protein: ENSMUSP00000111048
Gene: ENSMUSG00000072082

DomainStartEndE-ValueType
FBOX 35 75 1.56e-6 SMART
CYCLIN 315 399 2.25e-13 SMART
Cyclin_C 408 531 2.58e-19 SMART
CYCLIN 416 494 2.27e-9 SMART
low complexity region 545 555 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000124557
AA Change: A8S
SMART Domains Protein: ENSMUSP00000119405
Gene: ENSMUSG00000024118
AA Change: A8S

DomainStartEndE-ValueType
low complexity region 16 32 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149916
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171563
Meta Mutation Damage Score 0.1347 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,246,980 H618L probably benign Het
Adgrl3 A G 5: 81,766,234 T1230A probably benign Het
Ahnak2 A G 12: 112,785,739 S203P probably benign Het
Allc A G 12: 28,559,309 V244A probably benign Het
Ap3m1 G A 14: 21,037,157 P157L probably damaging Het
Arhgef2 T G 3: 88,632,943 I97S probably damaging Het
Btaf1 C A 19: 36,966,785 T398K probably benign Het
Cabp1 T C 5: 115,173,153 M158V probably damaging Het
Ccdc162 G A 10: 41,673,867 P340L probably benign Het
Clip4 A G 17: 71,834,222 K524E probably damaging Het
Cltc A G 11: 86,695,648 V189A probably benign Het
Cmc2 A G 8: 116,894,140 F34S probably damaging Het
Ctcfl G T 2: 173,113,656 T271N probably benign Het
Cyp4f16 T A 17: 32,542,764 F124I possibly damaging Het
Ddx41 C A 13: 55,531,648 R479L possibly damaging Het
Dgcr6 C A 16: 18,066,846 N87K possibly damaging Het
Dll1 A G 17: 15,368,859 L518P probably damaging Het
Dnaja4 G T 9: 54,710,644 M263I probably benign Het
Dusp13 T A 14: 21,743,525 probably benign Het
Fam185a T A 5: 21,480,377 I357N probably benign Het
Fam186a T C 15: 99,940,797 Y2522C unknown Het
Fam222a T A 5: 114,594,397 C4* probably null Het
Filip1 T C 9: 79,819,459 D626G probably damaging Het
Ghrhr C T 6: 55,388,187 R389C probably damaging Het
Gm8251 G A 1: 44,061,434 T168I possibly damaging Het
Gstm3 T A 3: 107,964,215 T217S probably benign Het
Gucy2g T C 19: 55,226,053 T548A probably benign Het
Hectd3 T A 4: 117,002,597 C744S probably null Het
Hnrnpl T C 7: 28,817,337 S184P probably benign Het
Il3 G A 11: 54,267,257 probably benign Het
Itga5 C T 15: 103,354,084 G330S probably damaging Het
Kl A G 5: 150,980,847 T355A possibly damaging Het
Lipk A C 19: 34,032,320 S208R probably damaging Het
Mrs2 T A 13: 24,999,057 probably null Het
Mutyh A G 4: 116,817,690 E372G probably damaging Het
Myh4 C A 11: 67,258,992 A1821D probably benign Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nlrp12 T C 7: 3,231,061 E881G probably damaging Het
Nol9 T C 4: 152,052,095 probably benign Het
Nwd1 A G 8: 72,657,131 E52G probably damaging Het
Olfr1025-ps1 A G 2: 85,918,404 T160A probably benign Het
Olfr1294 T A 2: 111,537,974 H105L probably damaging Het
Olfr1415 A G 1: 92,490,975 V260A probably benign Het
Olfr1508 A T 14: 52,463,646 M121K probably damaging Het
Olfr449 T G 6: 42,837,849 probably null Het
Opn4 A G 14: 34,596,304 V242A probably damaging Het
Paxbp1 G A 16: 91,034,978 Q341* probably null Het
Pcdh7 T C 5: 57,720,411 V436A possibly damaging Het
Pcdhb18 G A 18: 37,489,814 V66M probably damaging Het
Pikfyve A G 1: 65,246,590 E951G possibly damaging Het
Plcg1 A G 2: 160,750,986 N179S probably benign Het
Prr11 A C 11: 87,098,691 S285A probably benign Het
Ranbp17 A G 11: 33,328,451 S139P probably damaging Het
Rasa4 G A 5: 136,091,810 probably null Het
Rnf213 G C 11: 119,442,763 G2934R probably benign Het
Rpap1 A G 2: 119,778,251 V210A probably benign Het
Rpn1 T A 6: 88,090,205 N182K probably benign Het
Rps24 C T 14: 24,491,787 T14I possibly damaging Het
Rrp12 C T 19: 41,877,505 probably null Het
Rttn T A 18: 89,090,415 probably null Het
Rufy1 A G 11: 50,401,493 S490P probably damaging Het
Sec62 T A 3: 30,809,869 M100K unknown Het
Spata16 A G 3: 26,732,932 H253R possibly damaging Het
Srcap T C 7: 127,558,962 probably benign Het
Srrm1 A G 4: 135,345,512 probably benign Het
Tbcd G A 11: 121,582,785 probably null Het
Tnr A T 1: 159,684,788 probably benign Het
Tnxb A C 17: 34,718,007 D3730A probably damaging Het
Tor2a G A 2: 32,760,597 G201D probably damaging Het
Tpp1 T C 7: 105,746,649 T558A probably benign Het
Vmn1r211 G T 13: 22,852,126 Q124K probably benign Het
Wasf3 T C 5: 146,460,978 V185A probably benign Het
Zbtb12 A G 17: 34,896,009 T257A probably benign Het
Other mutations in Tedc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01963:Tedc2 APN 17 24217952 missense probably benign 0.01
IGL02111:Tedc2 APN 17 24218166 splice site probably benign
IGL02347:Tedc2 APN 17 24220610 missense probably damaging 1.00
IGL03400:Tedc2 APN 17 24219803 missense probably benign
R0766:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R0766:Tedc2 UTSW 17 24216318 nonsense probably null
R1066:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1066:Tedc2 UTSW 17 24216318 nonsense probably null
R1067:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1067:Tedc2 UTSW 17 24216318 nonsense probably null
R1085:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1085:Tedc2 UTSW 17 24216318 nonsense probably null
R1086:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1086:Tedc2 UTSW 17 24216318 nonsense probably null
R1136:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1136:Tedc2 UTSW 17 24216318 nonsense probably null
R1137:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1137:Tedc2 UTSW 17 24216318 nonsense probably null
R1203:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1203:Tedc2 UTSW 17 24216318 nonsense probably null
R1345:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1345:Tedc2 UTSW 17 24216318 nonsense probably null
R1385:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1385:Tedc2 UTSW 17 24216318 nonsense probably null
R1396:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1396:Tedc2 UTSW 17 24216318 nonsense probably null
R1888:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1888:Tedc2 UTSW 17 24216318 nonsense probably null
R1888:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1888:Tedc2 UTSW 17 24216318 nonsense probably null
R1891:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1891:Tedc2 UTSW 17 24216318 nonsense probably null
R1943:Tedc2 UTSW 17 24217949 missense possibly damaging 0.90
R1984:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1984:Tedc2 UTSW 17 24216318 nonsense probably null
R1985:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1985:Tedc2 UTSW 17 24216318 nonsense probably null
R1986:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1986:Tedc2 UTSW 17 24216318 nonsense probably null
R2026:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R2026:Tedc2 UTSW 17 24216318 nonsense probably null
R2054:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R2054:Tedc2 UTSW 17 24216318 nonsense probably null
R2086:Tedc2 UTSW 17 24217900 missense probably damaging 1.00
R2317:Tedc2 UTSW 17 24216384 missense probably benign 0.00
R3705:Tedc2 UTSW 17 24216387 missense probably benign 0.30
R4085:Tedc2 UTSW 17 24219839 missense probably benign 0.01
R4664:Tedc2 UTSW 17 24220140 splice site probably benign
R4676:Tedc2 UTSW 17 24220011 missense probably benign
R4686:Tedc2 UTSW 17 24217888 critical splice donor site probably null
R4762:Tedc2 UTSW 17 24216380 missense probably benign 0.05
R4863:Tedc2 UTSW 17 24217936 missense probably damaging 1.00
R5936:Tedc2 UTSW 17 24216341 missense probably damaging 1.00
RF031:Tedc2 UTSW 17 24216239 critical splice donor site probably benign
Z1177:Tedc2 UTSW 17 24220571 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGCATGCATTTGTATTTGGCC -3'
(R):5'- CTGTGCTCAAGATTGGGTAGC -3'

Sequencing Primer
(F):5'- CTTCTAGGCCCTGGGACTCTG -3'
(R):5'- TAGCCTACCCGGAAGTGG -3'
Posted On2016-03-01