Incidental Mutation 'R4837:Cyp4f16'
ID 374372
Institutional Source Beutler Lab
Gene Symbol Cyp4f16
Ensembl Gene ENSMUSG00000048440
Gene Name cytochrome P450, family 4, subfamily f, polypeptide 16
Synonyms
MMRRC Submission 042452-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4837 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 32536558-32551798 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 32542764 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 124 (F124I)
Ref Sequence ENSEMBL: ENSMUSP00000131058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003416] [ENSMUST00000165515] [ENSMUST00000169252] [ENSMUST00000169591]
AlphaFold Q99N17
Predicted Effect possibly damaging
Transcript: ENSMUST00000003416
AA Change: F124I

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000003416
Gene: ENSMUSG00000048440
AA Change: F124I

DomainStartEndE-ValueType
Pfam:p450 52 515 4.7e-133 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164628
Predicted Effect probably benign
Transcript: ENSMUST00000165515
SMART Domains Protein: ENSMUSP00000126845
Gene: ENSMUSG00000048440

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168346
Predicted Effect probably benign
Transcript: ENSMUST00000169252
SMART Domains Protein: ENSMUSP00000128349
Gene: ENSMUSG00000048440

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169591
AA Change: F124I

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131058
Gene: ENSMUSG00000048440
AA Change: F124I

DomainStartEndE-ValueType
Pfam:p450 52 515 4.7e-133 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170956
Meta Mutation Damage Score 0.1302 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,246,980 H618L probably benign Het
Adgrl3 A G 5: 81,766,234 T1230A probably benign Het
Ahnak2 A G 12: 112,785,739 S203P probably benign Het
Allc A G 12: 28,559,309 V244A probably benign Het
Ap3m1 G A 14: 21,037,157 P157L probably damaging Het
Arhgef2 T G 3: 88,632,943 I97S probably damaging Het
Btaf1 C A 19: 36,966,785 T398K probably benign Het
Cabp1 T C 5: 115,173,153 M158V probably damaging Het
Ccdc162 G A 10: 41,673,867 P340L probably benign Het
Clip4 A G 17: 71,834,222 K524E probably damaging Het
Cltc A G 11: 86,695,648 V189A probably benign Het
Cmc2 A G 8: 116,894,140 F34S probably damaging Het
Ctcfl G T 2: 173,113,656 T271N probably benign Het
Ddx41 C A 13: 55,531,648 R479L possibly damaging Het
Dgcr6 C A 16: 18,066,846 N87K possibly damaging Het
Dll1 A G 17: 15,368,859 L518P probably damaging Het
Dnaja4 G T 9: 54,710,644 M263I probably benign Het
Dusp13 T A 14: 21,743,525 probably benign Het
Fam185a T A 5: 21,480,377 I357N probably benign Het
Fam186a T C 15: 99,940,797 Y2522C unknown Het
Fam222a T A 5: 114,594,397 C4* probably null Het
Filip1 T C 9: 79,819,459 D626G probably damaging Het
Ghrhr C T 6: 55,388,187 R389C probably damaging Het
Gm8251 G A 1: 44,061,434 T168I possibly damaging Het
Gstm3 T A 3: 107,964,215 T217S probably benign Het
Gucy2g T C 19: 55,226,053 T548A probably benign Het
Hectd3 T A 4: 117,002,597 C744S probably null Het
Hnrnpl T C 7: 28,817,337 S184P probably benign Het
Il3 G A 11: 54,267,257 probably benign Het
Itga5 C T 15: 103,354,084 G330S probably damaging Het
Kl A G 5: 150,980,847 T355A possibly damaging Het
Lipk A C 19: 34,032,320 S208R probably damaging Het
Mrs2 T A 13: 24,999,057 probably null Het
Mutyh A G 4: 116,817,690 E372G probably damaging Het
Myh4 C A 11: 67,258,992 A1821D probably benign Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nlrp12 T C 7: 3,231,061 E881G probably damaging Het
Nol9 T C 4: 152,052,095 probably benign Het
Nwd1 A G 8: 72,657,131 E52G probably damaging Het
Olfr1025-ps1 A G 2: 85,918,404 T160A probably benign Het
Olfr1294 T A 2: 111,537,974 H105L probably damaging Het
Olfr1415 A G 1: 92,490,975 V260A probably benign Het
Olfr1508 A T 14: 52,463,646 M121K probably damaging Het
Olfr449 T G 6: 42,837,849 probably null Het
Opn4 A G 14: 34,596,304 V242A probably damaging Het
Paxbp1 G A 16: 91,034,978 Q341* probably null Het
Pcdh7 T C 5: 57,720,411 V436A possibly damaging Het
Pcdhb18 G A 18: 37,489,814 V66M probably damaging Het
Pikfyve A G 1: 65,246,590 E951G possibly damaging Het
Plcg1 A G 2: 160,750,986 N179S probably benign Het
Prr11 A C 11: 87,098,691 S285A probably benign Het
Ranbp17 A G 11: 33,328,451 S139P probably damaging Het
Rasa4 G A 5: 136,091,810 probably null Het
Rnf213 G C 11: 119,442,763 G2934R probably benign Het
Rpap1 A G 2: 119,778,251 V210A probably benign Het
Rpn1 T A 6: 88,090,205 N182K probably benign Het
Rps24 C T 14: 24,491,787 T14I possibly damaging Het
Rrp12 C T 19: 41,877,505 probably null Het
Rttn T A 18: 89,090,415 probably null Het
Rufy1 A G 11: 50,401,493 S490P probably damaging Het
Sec62 T A 3: 30,809,869 M100K unknown Het
Spata16 A G 3: 26,732,932 H253R possibly damaging Het
Srcap T C 7: 127,558,962 probably benign Het
Srrm1 A G 4: 135,345,512 probably benign Het
Tbcd G A 11: 121,582,785 probably null Het
Tedc2 C A 17: 24,220,593 A25S probably damaging Het
Tnr A T 1: 159,684,788 probably benign Het
Tnxb A C 17: 34,718,007 D3730A probably damaging Het
Tor2a G A 2: 32,760,597 G201D probably damaging Het
Tpp1 T C 7: 105,746,649 T558A probably benign Het
Vmn1r211 G T 13: 22,852,126 Q124K probably benign Het
Wasf3 T C 5: 146,460,978 V185A probably benign Het
Zbtb12 A G 17: 34,896,009 T257A probably benign Het
Other mutations in Cyp4f16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02941:Cyp4f16 APN 17 32537087 missense possibly damaging 0.75
IGL03400:Cyp4f16 APN 17 32550353 missense probably benign 0.00
R0437:Cyp4f16 UTSW 17 32537098 missense possibly damaging 0.46
R0454:Cyp4f16 UTSW 17 32537087 missense probably damaging 0.97
R0482:Cyp4f16 UTSW 17 32550551 missense probably damaging 1.00
R1422:Cyp4f16 UTSW 17 32542999 missense probably damaging 0.99
R1435:Cyp4f16 UTSW 17 32550734 nonsense probably null
R1440:Cyp4f16 UTSW 17 32550734 nonsense probably null
R1616:Cyp4f16 UTSW 17 32542968 nonsense probably null
R1840:Cyp4f16 UTSW 17 32543006 critical splice donor site probably null
R1854:Cyp4f16 UTSW 17 32537099 missense probably damaging 0.99
R1912:Cyp4f16 UTSW 17 32545044 missense probably damaging 0.99
R2200:Cyp4f16 UTSW 17 32537104 missense probably damaging 0.98
R3803:Cyp4f16 UTSW 17 32544884 missense possibly damaging 0.96
R4811:Cyp4f16 UTSW 17 32545106 missense probably benign
R4812:Cyp4f16 UTSW 17 32546678 missense probably null 1.00
R4867:Cyp4f16 UTSW 17 32550750 missense possibly damaging 0.94
R4909:Cyp4f16 UTSW 17 32550321 missense possibly damaging 0.46
R5857:Cyp4f16 UTSW 17 32537024 missense probably damaging 1.00
R5986:Cyp4f16 UTSW 17 32544142 missense probably benign 0.45
R6013:Cyp4f16 UTSW 17 32546678 missense probably null 1.00
R6408:Cyp4f16 UTSW 17 32551199 missense probably damaging 1.00
R6651:Cyp4f16 UTSW 17 32544144 missense probably benign 0.00
R7463:Cyp4f16 UTSW 17 32550787 missense possibly damaging 0.89
R7923:Cyp4f16 UTSW 17 32546747 missense possibly damaging 0.67
RF005:Cyp4f16 UTSW 17 32545195 splice site probably null
X0017:Cyp4f16 UTSW 17 32544936 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGAAAACATGGCGGACC -3'
(R):5'- GGGCTTCAGGATATCAAAGTGG -3'

Sequencing Primer
(F):5'- GACCATGTAGCAGTCTTGTCTAAG -3'
(R):5'- CTTCAGGATATCAAAGTGGAAGGC -3'
Posted On 2016-03-01