Incidental Mutation 'R4837:Clip4'
ID374375
Institutional Source Beutler Lab
Gene Symbol Clip4
Ensembl Gene ENSMUSG00000024059
Gene NameCAP-GLY domain containing linker protein family, member 4
Synonyms1700024K14Rik, Rsnl2, 1700074B05Rik, 4833417L20Rik, 5830409B12Rik
MMRRC Submission 042452-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R4837 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location71768473-71864273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71834222 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 524 (K524E)
Ref Sequence ENSEMBL: ENSMUSP00000154878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024854] [ENSMUST00000229304] [ENSMUST00000229874] [ENSMUST00000229952] [ENSMUST00000230305] [ENSMUST00000230333] [ENSMUST00000230747] [ENSMUST00000230749] [ENSMUST00000231105]
Predicted Effect probably damaging
Transcript: ENSMUST00000024854
AA Change: K524E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024854
Gene: ENSMUSG00000024059
AA Change: K524E

DomainStartEndE-ValueType
ANK 106 144 4.58e2 SMART
ANK 149 180 3.26e0 SMART
ANK 186 215 3.26e0 SMART
CAP_GLY 285 350 6.63e-34 SMART
low complexity region 358 371 N/A INTRINSIC
low complexity region 389 403 N/A INTRINSIC
low complexity region 423 432 N/A INTRINSIC
low complexity region 440 461 N/A INTRINSIC
low complexity region 469 478 N/A INTRINSIC
CAP_GLY 486 551 5.52e-31 SMART
low complexity region 575 586 N/A INTRINSIC
low complexity region 598 612 N/A INTRINSIC
CAP_GLY 624 690 5.65e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229014
Predicted Effect probably benign
Transcript: ENSMUST00000229304
Predicted Effect probably damaging
Transcript: ENSMUST00000229874
AA Change: K524E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229903
Predicted Effect probably damaging
Transcript: ENSMUST00000229952
AA Change: K477E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect unknown
Transcript: ENSMUST00000230160
AA Change: K216E
Predicted Effect probably damaging
Transcript: ENSMUST00000230305
AA Change: K524E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000230333
AA Change: K524E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000230747
Predicted Effect probably benign
Transcript: ENSMUST00000230749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230845
Predicted Effect probably benign
Transcript: ENSMUST00000231105
Predicted Effect probably benign
Transcript: ENSMUST00000231131
Meta Mutation Damage Score 0.9672 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,246,980 H618L probably benign Het
Adgrl3 A G 5: 81,766,234 T1230A probably benign Het
Ahnak2 A G 12: 112,785,739 S203P probably benign Het
Allc A G 12: 28,559,309 V244A probably benign Het
Ap3m1 G A 14: 21,037,157 P157L probably damaging Het
Arhgef2 T G 3: 88,632,943 I97S probably damaging Het
Btaf1 C A 19: 36,966,785 T398K probably benign Het
Cabp1 T C 5: 115,173,153 M158V probably damaging Het
Ccdc162 G A 10: 41,673,867 P340L probably benign Het
Cltc A G 11: 86,695,648 V189A probably benign Het
Cmc2 A G 8: 116,894,140 F34S probably damaging Het
Ctcfl G T 2: 173,113,656 T271N probably benign Het
Cyp4f16 T A 17: 32,542,764 F124I possibly damaging Het
Ddx41 C A 13: 55,531,648 R479L possibly damaging Het
Dgcr6 C A 16: 18,066,846 N87K possibly damaging Het
Dll1 A G 17: 15,368,859 L518P probably damaging Het
Dnaja4 G T 9: 54,710,644 M263I probably benign Het
Dusp13 T A 14: 21,743,525 probably benign Het
Fam185a T A 5: 21,480,377 I357N probably benign Het
Fam186a T C 15: 99,940,797 Y2522C unknown Het
Fam222a T A 5: 114,594,397 C4* probably null Het
Filip1 T C 9: 79,819,459 D626G probably damaging Het
Ghrhr C T 6: 55,388,187 R389C probably damaging Het
Gm8251 G A 1: 44,061,434 T168I possibly damaging Het
Gstm3 T A 3: 107,964,215 T217S probably benign Het
Gucy2g T C 19: 55,226,053 T548A probably benign Het
Hectd3 T A 4: 117,002,597 C744S probably null Het
Hnrnpl T C 7: 28,817,337 S184P probably benign Het
Il3 G A 11: 54,267,257 probably benign Het
Itga5 C T 15: 103,354,084 G330S probably damaging Het
Kl A G 5: 150,980,847 T355A possibly damaging Het
Lipk A C 19: 34,032,320 S208R probably damaging Het
Mrs2 T A 13: 24,999,057 probably null Het
Mutyh A G 4: 116,817,690 E372G probably damaging Het
Myh4 C A 11: 67,258,992 A1821D probably benign Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nlrp12 T C 7: 3,231,061 E881G probably damaging Het
Nol9 T C 4: 152,052,095 probably benign Het
Nwd1 A G 8: 72,657,131 E52G probably damaging Het
Olfr1025-ps1 A G 2: 85,918,404 T160A probably benign Het
Olfr1294 T A 2: 111,537,974 H105L probably damaging Het
Olfr1415 A G 1: 92,490,975 V260A probably benign Het
Olfr1508 A T 14: 52,463,646 M121K probably damaging Het
Olfr449 T G 6: 42,837,849 probably null Het
Opn4 A G 14: 34,596,304 V242A probably damaging Het
Paxbp1 G A 16: 91,034,978 Q341* probably null Het
Pcdh7 T C 5: 57,720,411 V436A possibly damaging Het
Pcdhb18 G A 18: 37,489,814 V66M probably damaging Het
Pikfyve A G 1: 65,246,590 E951G possibly damaging Het
Plcg1 A G 2: 160,750,986 N179S probably benign Het
Prr11 A C 11: 87,098,691 S285A probably benign Het
Ranbp17 A G 11: 33,328,451 S139P probably damaging Het
Rasa4 G A 5: 136,091,810 probably null Het
Rnf213 G C 11: 119,442,763 G2934R probably benign Het
Rpap1 A G 2: 119,778,251 V210A probably benign Het
Rpn1 T A 6: 88,090,205 N182K probably benign Het
Rps24 C T 14: 24,491,787 T14I possibly damaging Het
Rrp12 C T 19: 41,877,505 probably null Het
Rttn T A 18: 89,090,415 probably null Het
Rufy1 A G 11: 50,401,493 S490P probably damaging Het
Sec62 T A 3: 30,809,869 M100K unknown Het
Spata16 A G 3: 26,732,932 H253R possibly damaging Het
Srcap T C 7: 127,558,962 probably benign Het
Srrm1 A G 4: 135,345,512 probably benign Het
Tbcd G A 11: 121,582,785 probably null Het
Tedc2 C A 17: 24,220,593 A25S probably damaging Het
Tnr A T 1: 159,684,788 probably benign Het
Tnxb A C 17: 34,718,007 D3730A probably damaging Het
Tor2a G A 2: 32,760,597 G201D probably damaging Het
Tpp1 T C 7: 105,746,649 T558A probably benign Het
Vmn1r211 G T 13: 22,852,126 Q124K probably benign Het
Wasf3 T C 5: 146,460,978 V185A probably benign Het
Zbtb12 A G 17: 34,896,009 T257A probably benign Het
Other mutations in Clip4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Clip4 APN 17 71849942 missense probably damaging 1.00
IGL01011:Clip4 APN 17 71849939 missense probably benign 0.02
IGL01086:Clip4 APN 17 71824794 missense probably benign 0.00
IGL01712:Clip4 APN 17 71799041 missense probably damaging 1.00
IGL01833:Clip4 APN 17 71827790 unclassified probably benign
IGL02150:Clip4 APN 17 71799076 missense probably damaging 1.00
IGL02378:Clip4 APN 17 71837726 missense possibly damaging 0.94
IGL02597:Clip4 APN 17 71849970 splice site probably benign
IGL02676:Clip4 APN 17 71828621 missense probably damaging 1.00
PIT4243001:Clip4 UTSW 17 71806728 missense probably damaging 0.98
R0525:Clip4 UTSW 17 71799098 critical splice donor site probably null
R0737:Clip4 UTSW 17 71837699 nonsense probably null
R1791:Clip4 UTSW 17 71801942 splice site probably benign
R1908:Clip4 UTSW 17 71837749 missense probably damaging 1.00
R2290:Clip4 UTSW 17 71810953 missense possibly damaging 0.96
R3701:Clip4 UTSW 17 71799008 missense probably damaging 0.96
R4001:Clip4 UTSW 17 71799076 missense probably damaging 1.00
R4013:Clip4 UTSW 17 71856546 nonsense probably null
R4589:Clip4 UTSW 17 71810867 nonsense probably null
R5174:Clip4 UTSW 17 71810962 missense probably damaging 1.00
R5239:Clip4 UTSW 17 71799077 missense probably damaging 1.00
R5298:Clip4 UTSW 17 71834225 missense probably damaging 1.00
R5535:Clip4 UTSW 17 71831262 missense probably benign
R5667:Clip4 UTSW 17 71789883 start codon destroyed probably damaging 1.00
R5671:Clip4 UTSW 17 71789883 start codon destroyed probably damaging 1.00
R5730:Clip4 UTSW 17 71810959 missense probably damaging 1.00
R5768:Clip4 UTSW 17 71806499 splice site probably null
R5913:Clip4 UTSW 17 71824765 missense probably benign 0.00
R5974:Clip4 UTSW 17 71831247 missense probably damaging 1.00
R5996:Clip4 UTSW 17 71856310 missense probably damaging 0.99
R6176:Clip4 UTSW 17 71806633 nonsense probably null
R6371:Clip4 UTSW 17 71856464 missense probably damaging 1.00
R6386:Clip4 UTSW 17 71834194 nonsense probably null
R7296:Clip4 UTSW 17 71790001 missense probably damaging 0.99
R7546:Clip4 UTSW 17 71828702 missense possibly damaging 0.85
R7548:Clip4 UTSW 17 71789968 missense probably benign
R7616:Clip4 UTSW 17 71834273 missense probably benign 0.00
R8054:Clip4 UTSW 17 71834273 missense possibly damaging 0.68
R8056:Clip4 UTSW 17 71803592 missense probably damaging 1.00
Z1177:Clip4 UTSW 17 71799097 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCCACTGAAACGTTTCTCC -3'
(R):5'- GCCTGTGCTTATCTTCCAGATG -3'

Sequencing Primer
(F):5'- CATCTGAGAGCTTAATGATCATGATG -3'
(R):5'- TCCAGATGGAATCGGGGACC -3'
Posted On2016-03-01