Incidental Mutation 'R4398:Nelfa'
ID374382
Institutional Source Beutler Lab
Gene Symbol Nelfa
Ensembl Gene ENSMUSG00000029111
Gene Namenegative elongation factor complex member A, Whsc2
SynonymsWhsc2, Nelf-A, Whsc2h
MMRRC Submission 041130-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4398 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location33897916-33936413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33901279 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 279 (D279G)
Ref Sequence ENSEMBL: ENSMUSP00000030993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030993] [ENSMUST00000066854] [ENSMUST00000075812] [ENSMUST00000137191] [ENSMUST00000139845]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030993
AA Change: D279G

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030993
Gene: ENSMUSG00000029111
AA Change: D279G

DomainStartEndE-ValueType
low complexity region 54 63 N/A INTRINSIC
low complexity region 280 294 N/A INTRINSIC
low complexity region 315 333 N/A INTRINSIC
low complexity region 339 365 N/A INTRINSIC
low complexity region 383 429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066854
SMART Domains Protein: ENSMUSP00000067205
Gene: ENSMUSG00000057406

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
PWWP 220 285 3.84e-15 SMART
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
low complexity region 630 644 N/A INTRINSIC
PHD 670 712 1.36e-6 SMART
RING 671 711 1.5e1 SMART
PHD 717 764 6.81e-1 SMART
RING 718 763 5.25e-2 SMART
PHD 834 874 2.35e-10 SMART
PWWP 879 941 2.67e-23 SMART
AWS 1012 1063 3.74e-27 SMART
SET 1064 1187 4.48e-43 SMART
PostSET 1188 1204 7.56e-4 SMART
low complexity region 1216 1237 N/A INTRINSIC
PHD 1242 1285 1.98e-8 SMART
low complexity region 1348 1361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075812
SMART Domains Protein: ENSMUSP00000075210
Gene: ENSMUSG00000057406

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
PWWP 220 285 3.84e-15 SMART
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
low complexity region 630 644 N/A INTRINSIC
PHD 670 712 1.36e-6 SMART
RING 671 711 1.5e1 SMART
PHD 717 764 6.81e-1 SMART
RING 718 763 5.25e-2 SMART
PHD 834 874 2.35e-10 SMART
PWWP 879 941 2.67e-23 SMART
AWS 1012 1063 3.74e-27 SMART
SET 1064 1187 4.48e-43 SMART
PostSET 1188 1204 7.56e-4 SMART
low complexity region 1216 1237 N/A INTRINSIC
PHD 1242 1285 1.98e-8 SMART
low complexity region 1348 1361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137191
SMART Domains Protein: ENSMUSP00000122310
Gene: ENSMUSG00000057406

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:PWWP 220 332 4.9e-26 PFAM
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139845
SMART Domains Protein: ENSMUSP00000123460
Gene: ENSMUSG00000057406

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:PWWP 220 332 4.9e-26 PFAM
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183676
Meta Mutation Damage Score 0.1474 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed ubiquitously with higher levels in fetal than in adult tissues. It encodes a protein sharing 93% sequence identity with the mouse protein. Wolf-Hirschhorn syndrome (WHS) is a malformation syndrome associated with a hemizygous deletion of the distal short arm of chromosome 4. This gene is mapped to the 165 kb WHS critical region, and may play a role in the phenotype of the WHS or Pitt-Rogers-Danks syndrome. The encoded protein is found to be capable of reacting with HLA-A2-restricted and tumor-specific cytotoxic T lymphocytes, suggesting a target for use in specific immunotherapy for a large number of cancer patients. This protein has also been shown to be a member of the NELF (negative elongation factor) protein complex that participates in the regulation of RNA polymerase II transcription elongation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 C A 15: 94,333,695 R871L possibly damaging Het
Adcy5 G A 16: 35,268,993 C520Y probably damaging Het
AI661453 G A 17: 47,468,117 probably benign Het
Bptf T C 11: 107,110,844 K481E probably damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Ctc1 C T 11: 69,022,871 P200S probably damaging Het
Dact1 T C 12: 71,317,185 Y210H probably damaging Het
Dbn1 T C 13: 55,475,381 T430A probably benign Het
Dmd A C X: 83,722,018 T657P probably benign Het
Efnb2 C T 8: 8,620,832 R256H possibly damaging Het
Eif4a1 T C 11: 69,669,244 I116M possibly damaging Het
F730035P03Rik A T 7: 99,780,268 noncoding transcript Het
Fbn1 C T 2: 125,397,781 V329I probably benign Het
Gpr20 G A 15: 73,696,276 T88I probably benign Het
Herc1 T G 9: 66,479,453 V3783G probably benign Het
Khdc1a A G 1: 21,350,393 D79G possibly damaging Het
Klk1b16 A T 7: 44,141,427 I218F probably damaging Het
Malrd1 C T 2: 16,150,783 T2001I unknown Het
Mia3 A G 1: 183,330,878 S556P probably damaging Het
Myo3a T A 2: 22,577,842 D369E probably benign Het
Ntrk3 A T 7: 78,250,769 C607* probably null Het
Olfr53 T C 7: 140,652,828 V283A possibly damaging Het
Pclo A T 5: 14,775,366 Q1371L probably damaging Het
Pdzd2 A T 15: 12,375,975 V1358E probably benign Het
Pgr T C 9: 8,903,749 probably null Het
Prag1 A G 8: 36,103,655 D464G probably damaging Het
Prickle4 A G 17: 47,690,531 probably benign Het
Prim2 A G 1: 33,512,111 Y309H probably damaging Het
Prkaa1 A G 15: 5,177,161 Q464R possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rint1 T A 5: 23,794,447 I78K possibly damaging Het
Rnf130 T A 11: 50,071,378 F217Y probably benign Het
Smad7 T C 18: 75,394,163 V360A probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stag1 A G 9: 100,956,606 probably benign Het
Tlr12 T A 4: 128,616,195 D754V probably benign Het
Tmf1 G A 6: 97,178,896 P43L probably damaging Het
Togaram1 A G 12: 64,980,856 N873S probably benign Het
Tsn C T 1: 118,311,069 probably benign Het
Ubn1 A G 16: 5,064,425 K250R probably damaging Het
Vmn1r25 A T 6: 57,978,827 V159D probably damaging Het
Vmn2r89 T C 14: 51,452,094 L18P probably damaging Het
Vps8 T G 16: 21,504,466 N689K probably damaging Het
Ythdc1 T A 5: 86,815,654 D30E possibly damaging Het
Ythdc1 G T 5: 86,835,820 probably benign Het
Zfp407 G A 18: 84,562,731 Q86* probably null Het
Zfp521 C T 18: 13,846,544 E271K probably benign Het
Other mutations in Nelfa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Nelfa APN 5 33898802 missense probably damaging 0.98
R0590:Nelfa UTSW 5 33901825 missense probably damaging 1.00
R0613:Nelfa UTSW 5 33903463 splice site probably benign
R1533:Nelfa UTSW 5 33898871 missense probably damaging 0.98
R2181:Nelfa UTSW 5 33900509 missense probably benign 0.43
R4246:Nelfa UTSW 5 33899029 missense probably damaging 1.00
R4657:Nelfa UTSW 5 33901813 missense probably benign 0.08
R4973:Nelfa UTSW 5 33901818 missense probably benign 0.04
R5424:Nelfa UTSW 5 33921845 critical splice donor site probably null
R5614:Nelfa UTSW 5 33920500 missense probably damaging 1.00
R5737:Nelfa UTSW 5 33899113 critical splice acceptor site probably null
R6135:Nelfa UTSW 5 33899276 splice site probably null
R6153:Nelfa UTSW 5 33898879 missense probably damaging 1.00
R7231:Nelfa UTSW 5 33898825 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGTAATCCTAGAATGAGGC -3'
(R):5'- GCTTCTGCCAGTATAGAGTGGG -3'

Sequencing Primer
(F):5'- GGCAGGTATTTGTTCCAAACACG -3'
(R):5'- ACAAGGTCTGTACACTGTGGTCC -3'
Posted On2016-03-02