Incidental Mutation 'R4398:Tmf1'
ID374383
Institutional Source Beutler Lab
Gene Symbol Tmf1
Ensembl Gene ENSMUSG00000030059
Gene NameTATA element modulatory factor 1
Synonyms7030402D04Rik, LOC232286
MMRRC Submission 041130-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R4398 (G1)
Quality Score36
Status Validated
Chromosome6
Chromosomal Location97152997-97179122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 97178896 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 43 (P43L)
Ref Sequence ENSEMBL: ENSMUSP00000120093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095664] [ENSMUST00000124173] [ENSMUST00000164744] [ENSMUST00000204056]
Predicted Effect probably damaging
Transcript: ENSMUST00000095664
AA Change: P43L

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093325
Gene: ENSMUSG00000030059
AA Change: P43L

DomainStartEndE-ValueType
low complexity region 111 122 N/A INTRINSIC
low complexity region 131 142 N/A INTRINSIC
low complexity region 194 211 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 261 276 N/A INTRINSIC
low complexity region 367 381 N/A INTRINSIC
low complexity region 410 426 N/A INTRINSIC
coiled coil region 443 536 N/A INTRINSIC
Pfam:TMF_DNA_bd 540 613 5e-24 PFAM
low complexity region 697 715 N/A INTRINSIC
low complexity region 719 732 N/A INTRINSIC
low complexity region 803 821 N/A INTRINSIC
coiled coil region 823 894 N/A INTRINSIC
low complexity region 923 937 N/A INTRINSIC
Pfam:TMF_TATA_bd 972 1085 1.5e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124173
AA Change: P43L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120093
Gene: ENSMUSG00000030059
AA Change: P43L

DomainStartEndE-ValueType
low complexity region 111 122 N/A INTRINSIC
low complexity region 131 142 N/A INTRINSIC
low complexity region 194 211 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 261 276 N/A INTRINSIC
low complexity region 367 381 N/A INTRINSIC
low complexity region 410 426 N/A INTRINSIC
coiled coil region 443 536 N/A INTRINSIC
Pfam:TMF_DNA_bd 540 613 1.4e-24 PFAM
low complexity region 697 715 N/A INTRINSIC
low complexity region 719 732 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164744
SMART Domains Protein: ENSMUSP00000130954
Gene: ENSMUSG00000030061

DomainStartEndE-ValueType
Pfam:ThiF 54 199 1.5e-41 PFAM
Pfam:UBA_e1_thiolCys 202 248 8.7e-15 PFAM
Pfam:UBACT 255 321 9e-25 PFAM
E2_bind 360 448 1.02e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204056
SMART Domains Protein: ENSMUSP00000145309
Gene: ENSMUSG00000030061

DomainStartEndE-ValueType
low complexity region 5 56 N/A INTRINSIC
Meta Mutation Damage Score 0.3994 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 96% (53/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility associated with decreased testis weight, globozoospermia, absent acrosome, asthenozoospermia, and abnormal sperm midpiece morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 C A 15: 94,333,695 R871L possibly damaging Het
Adcy5 G A 16: 35,268,993 C520Y probably damaging Het
AI661453 G A 17: 47,468,117 probably benign Het
Bptf T C 11: 107,110,844 K481E probably damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Ctc1 C T 11: 69,022,871 P200S probably damaging Het
Dact1 T C 12: 71,317,185 Y210H probably damaging Het
Dbn1 T C 13: 55,475,381 T430A probably benign Het
Dmd A C X: 83,722,018 T657P probably benign Het
Efnb2 C T 8: 8,620,832 R256H possibly damaging Het
Eif4a1 T C 11: 69,669,244 I116M possibly damaging Het
F730035P03Rik A T 7: 99,780,268 noncoding transcript Het
Fbn1 C T 2: 125,397,781 V329I probably benign Het
Gpr20 G A 15: 73,696,276 T88I probably benign Het
Herc1 T G 9: 66,479,453 V3783G probably benign Het
Khdc1a A G 1: 21,350,393 D79G possibly damaging Het
Klk1b16 A T 7: 44,141,427 I218F probably damaging Het
Malrd1 C T 2: 16,150,783 T2001I unknown Het
Mia3 A G 1: 183,330,878 S556P probably damaging Het
Myo3a T A 2: 22,577,842 D369E probably benign Het
Nelfa T C 5: 33,901,279 D279G possibly damaging Het
Ntrk3 A T 7: 78,250,769 C607* probably null Het
Olfr53 T C 7: 140,652,828 V283A possibly damaging Het
Pclo A T 5: 14,775,366 Q1371L probably damaging Het
Pdzd2 A T 15: 12,375,975 V1358E probably benign Het
Pgr T C 9: 8,903,749 probably null Het
Prag1 A G 8: 36,103,655 D464G probably damaging Het
Prickle4 A G 17: 47,690,531 probably benign Het
Prim2 A G 1: 33,512,111 Y309H probably damaging Het
Prkaa1 A G 15: 5,177,161 Q464R possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rint1 T A 5: 23,794,447 I78K possibly damaging Het
Rnf130 T A 11: 50,071,378 F217Y probably benign Het
Smad7 T C 18: 75,394,163 V360A probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stag1 A G 9: 100,956,606 probably benign Het
Tlr12 T A 4: 128,616,195 D754V probably benign Het
Togaram1 A G 12: 64,980,856 N873S probably benign Het
Tsn C T 1: 118,311,069 probably benign Het
Ubn1 A G 16: 5,064,425 K250R probably damaging Het
Vmn1r25 A T 6: 57,978,827 V159D probably damaging Het
Vmn2r89 T C 14: 51,452,094 L18P probably damaging Het
Vps8 T G 16: 21,504,466 N689K probably damaging Het
Ythdc1 T A 5: 86,815,654 D30E possibly damaging Het
Ythdc1 G T 5: 86,835,820 probably benign Het
Zfp407 G A 18: 84,562,731 Q86* probably null Het
Zfp521 C T 18: 13,846,544 E271K probably benign Het
Other mutations in Tmf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Tmf1 APN 6 97176494 missense probably benign 0.00
IGL00846:Tmf1 APN 6 97173316 missense possibly damaging 0.88
IGL01575:Tmf1 APN 6 97175936 missense probably damaging 1.00
IGL01922:Tmf1 APN 6 97176930 missense probably benign 0.00
IGL02550:Tmf1 APN 6 97158561 missense probably benign 0.28
IGL02675:Tmf1 APN 6 97164042 splice site probably benign
IGL02985:Tmf1 APN 6 97176809 missense probably damaging 1.00
IGL03324:Tmf1 APN 6 97163653 missense probably damaging 0.99
caddy UTSW 6 97161447 nonsense probably null
R0028:Tmf1 UTSW 6 97158098 missense probably damaging 1.00
R0153:Tmf1 UTSW 6 97170384 missense probably damaging 0.97
R0325:Tmf1 UTSW 6 97176504 missense possibly damaging 0.51
R0420:Tmf1 UTSW 6 97176141 missense probably damaging 1.00
R0730:Tmf1 UTSW 6 97176492 missense probably benign
R0825:Tmf1 UTSW 6 97175995 missense probably benign
R0827:Tmf1 UTSW 6 97158050 nonsense probably null
R0839:Tmf1 UTSW 6 97176323 missense probably damaging 1.00
R1078:Tmf1 UTSW 6 97173300 missense probably damaging 1.00
R1905:Tmf1 UTSW 6 97161479 missense possibly damaging 0.53
R2274:Tmf1 UTSW 6 97163586 missense probably damaging 1.00
R3701:Tmf1 UTSW 6 97172331 missense possibly damaging 0.51
R3953:Tmf1 UTSW 6 97176206 missense probably damaging 0.99
R3955:Tmf1 UTSW 6 97176206 missense probably damaging 0.99
R4416:Tmf1 UTSW 6 97178988 missense probably damaging 1.00
R4497:Tmf1 UTSW 6 97172332 missense probably benign 0.00
R4592:Tmf1 UTSW 6 97173400 missense probably benign 0.00
R4669:Tmf1 UTSW 6 97170427 missense probably benign 0.00
R5214:Tmf1 UTSW 6 97167292 missense possibly damaging 0.81
R5352:Tmf1 UTSW 6 97176809 missense probably damaging 1.00
R5530:Tmf1 UTSW 6 97158087 missense probably damaging 1.00
R5815:Tmf1 UTSW 6 97173403 missense probably benign 0.28
R6806:Tmf1 UTSW 6 97161447 nonsense probably null
R6837:Tmf1 UTSW 6 97176581 missense possibly damaging 0.76
R6853:Tmf1 UTSW 6 97168849 missense probably damaging 0.99
R6887:Tmf1 UTSW 6 97176838 missense probably damaging 1.00
R7058:Tmf1 UTSW 6 97156950 missense probably damaging 1.00
R7145:Tmf1 UTSW 6 97176118 missense probably damaging 1.00
R7340:Tmf1 UTSW 6 97168100 missense possibly damaging 0.81
R7573:Tmf1 UTSW 6 97158494 missense probably benign 0.14
R7809:Tmf1 UTSW 6 97161459 missense probably damaging 0.99
R7833:Tmf1 UTSW 6 97161411 missense probably benign 0.06
R7916:Tmf1 UTSW 6 97161411 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCCTAGCAATTGGGGATCTG -3'
(R):5'- GTTGAGAACGGCCATGAAGC -3'

Sequencing Primer
(F):5'- CAATTGGGGATCTGGGGCTG -3'
(R):5'- TGGTAACTAAGGGCTCCGCTC -3'
Posted On2016-03-02