Mutagenetix > Incidental Mutation

Incidental Mutation 'R0280:Fut9'

37441

Institutional Source

Beutler Lab

Gene Symbol

Fut9

Ensembl Gene

ENSMUSG00000055373

Gene Name

fucosyltransferase 9

Synonyms

mFuc-TIX, mFUT9

MMRRC Submission

038502-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0280 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25609332-25800244 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 25619852 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 321 (D321N)

Ref Sequence

ENSEMBL: ENSMUSP00000103834 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084770] [ENSMUST00000108199]

AlphaFold

O88819

Predicted Effect

probably benign
Transcript: ENSMUST00000084770
AA Change: D321N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000081826
Gene: ENSMUSG00000055373
AA Change: D321N

Domain	Start	End	E-Value	Type
Pfam:Glyco_transf_10	6	358	2.9e-140	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108199
AA Change: D321N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000103834
Gene: ENSMUSG00000055373
AA Change: D321N

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:Glyco_tran_10_N	61	169	1.4e-43	PFAM
Pfam:Glyco_transf_10	185	357	4.8e-69	PFAM

Meta Mutation Damage Score

0.0684

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.9%
20x: 94.6%

Validation Efficiency

96% (55/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It is localized to the golgi, and catalyzes the last step in the biosynthesis of Lewis X (LeX) antigen, the addition of a fucose to precursor polysaccharides. This protein is one of the few fucosyltransferases that synthesizes the LeX oligosaccharide (CD15) expressed in the organ buds progressing in mesenchyma during embryogenesis. It is also responsible for the expression of CD15 in mature granulocytes. A common haplotype of this gene has also been associated with susceptibility to placental malaria infection. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased number of neuronal stem cells with increased self-renewal capacity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
Adam18	C	T	8: 24,674,054	G38R	probably benign	Het
Ankrd16	T	G	2: 11,781,501	V187G	probably damaging	Het
AU019823	T	C	9: 50,609,379	T123A	probably damaging	Het
Ccdc110	A	T	8: 45,943,450	N793Y	probably benign	Het
Ccdc170	T	C	10: 4,558,663	I629T	possibly damaging	Het
Clcn6	A	G	4: 148,008,715	L836P	probably damaging	Het
Colgalt2	G	T	1: 152,508,561	A551S	possibly damaging	Het
Crocc	T	C	4: 141,028,426	E1097G	probably damaging	Het
Csmd1	A	T	8: 16,271,602	V494E	probably damaging	Het
Drg1	A	T	11: 3,256,537		probably null	Het
Dscam	T	C	16: 97,039,006	K134E	possibly damaging	Het
Dyrk1b	T	C	7: 28,184,312	Y198H	probably damaging	Het
Esr1	A	G	10: 4,856,951	D289G	probably benign	Het
Esr1	G	T	10: 4,939,289	V396F	probably damaging	Het
Evi5l	T	C	8: 4,193,133	V339A	probably damaging	Het
Fat4	A	T	3: 38,890,816	Q1286L	probably benign	Het
Frem1	T	C	4: 82,969,444	H1118R	probably damaging	Het
Fuk	A	T	8: 110,894,748	V188D	probably damaging	Het
Gaa	T	G	11: 119,284,547	V917G	probably damaging	Het
Gm973	GCC	GC	1: 59,544,680		probably null	Het
Kidins220	A	G	12: 25,010,141	T767A	probably damaging	Het
Kif7	A	G	7: 79,698,823	S1257P	probably benign	Het
Ltn1	A	G	16: 87,397,838	L1391P	probably damaging	Het
Mast3	A	G	8: 70,783,795	Y681H	probably damaging	Het
Mast3	A	G	8: 70,787,920	V291A	possibly damaging	Het
Metrn	C	T	17: 25,795,135	R239H	probably benign	Het
Mphosph10	C	A	7: 64,376,703	K666N	possibly damaging	Het
Mtbp	C	T	15: 55,586,461	T433I	probably benign	Het
Mtmr2	A	G	9: 13,799,249	K365E	probably damaging	Het
Nanog	A	G	6: 122,713,398	D229G	probably damaging	Het
Npepps	T	C	11: 97,241,014	N338S	possibly damaging	Het
Nphp4	T	A	4: 152,551,936		probably benign	Het
Olfr1279	T	C	2: 111,307,072	F289S	possibly damaging	Het
Plcl2	A	G	17: 50,607,034	E357G	probably damaging	Het
Polb	A	T	8: 22,640,392	Y173N	probably damaging	Het
R3hdm1	T	A	1: 128,162,775	S74T	probably benign	Het
Raet1d	T	A	10: 22,370,883	C37S	probably damaging	Het
Reln	G	A	5: 22,227,513		probably benign	Het
Rps6kc1	T	C	1: 190,809,000	S369G	probably damaging	Het
Sgf29	A	G	7: 126,671,571	E108G	probably benign	Het
Sh3tc1	A	G	5: 35,706,017	L942P	probably damaging	Het
Slc22a27	A	T	19: 7,896,822	L188*	probably null	Het
Slc9a3	T	A	13: 74,159,424	I445N	probably damaging	Het
Sufu	A	T	19: 46,450,673		probably benign	Het
Tomm40	G	A	7: 19,713,751	T118I	probably damaging	Het
Ttc25	A	T	11: 100,550,265	K107N	probably damaging	Het
Ttn	C	T	2: 76,740,479	R26690H	probably damaging	Het
Vmn2r16	A	G	5: 109,340,139	I293V	possibly damaging	Het
Vmn2r68	T	A	7: 85,233,249		probably benign	Het
Vmn2r68	C	G	7: 85,233,258		probably null	Het
Vsig8	A	G	1: 172,561,538	D119G	probably benign	Het

Other mutations in Fut9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00919:Fut9	APN	4	25620316	missense	possibly damaging	0.71
IGL01134:Fut9	APN	4	25620446	missense	probably benign	0.13
IGL01330:Fut9	APN	4	25619791	missense	possibly damaging	0.95
IGL01732:Fut9	APN	4	25619867	missense	possibly damaging	0.58
IGL02824:Fut9	APN	4	25620037	missense	probably damaging	1.00
ANU74:Fut9	UTSW	4	25620802	missense	probably benign	0.25
R0408:Fut9	UTSW	4	25620319	missense	possibly damaging	0.69
R0594:Fut9	UTSW	4	25620526	missense	possibly damaging	0.94
R0609:Fut9	UTSW	4	25620811	start codon destroyed	probably null	0.98
R0709:Fut9	UTSW	4	25620359	missense	probably damaging	1.00
R1567:Fut9	UTSW	4	25620344	missense	probably damaging	0.99
R1719:Fut9	UTSW	4	25619744	missense	possibly damaging	0.62
R1856:Fut9	UTSW	4	25620352	missense	probably damaging	1.00
R2036:Fut9	UTSW	4	25620322	missense	probably damaging	1.00
R2165:Fut9	UTSW	4	25619733	makesense	probably null
R2165:Fut9	UTSW	4	25619734	makesense	probably null
R2332:Fut9	UTSW	4	25619823	nonsense	probably null
R4539:Fut9	UTSW	4	25619793	missense	probably damaging	1.00
R4722:Fut9	UTSW	4	25799734	utr 5 prime	probably benign
R4766:Fut9	UTSW	4	25799191	intron	probably benign
R4937:Fut9	UTSW	4	25799591	splice site	probably benign
R5025:Fut9	UTSW	4	25620502	missense	probably damaging	1.00
R5032:Fut9	UTSW	4	25799245	intron	probably benign
R5158:Fut9	UTSW	4	25620731	missense	probably benign	0.01
R5601:Fut9	UTSW	4	25620299	missense	probably benign	0.00
R5974:Fut9	UTSW	4	25620090	nonsense	probably null
R6315:Fut9	UTSW	4	25619774	missense	probably damaging	1.00
R6385:Fut9	UTSW	4	25620328	missense	probably damaging	1.00
R6652:Fut9	UTSW	4	25620619	missense	probably benign	0.44
R6809:Fut9	UTSW	4	25620647	missense	probably benign
R6825:Fut9	UTSW	4	25619925	missense	probably benign
R7145:Fut9	UTSW	4	25620507	missense	probably damaging	0.96
R7573:Fut9	UTSW	4	25620691	missense	probably benign	0.04
R8933:Fut9	UTSW	4	25619861	missense	probably damaging	1.00
R9715:Fut9	UTSW	4	25620679	missense	probably benign	0.00
X0057:Fut9	UTSW	4	25799686	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- AAATTAAACGGTGCCCCAAATGCAG -3'
(R):5'- GCCAGGGTCAAGTATTACAACGAGC -3'

Sequencing Primer
(F):5'- CCCAAATGCAGCGTGTTTC -3'
(R):5'- GAGTATTGAAATCCACACCTATGGC -3'

Posted On

2013-05-23