Incidental Mutation 'R4439:Slco4a1'
ID 374412
Institutional Source Beutler Lab
Gene Symbol Slco4a1
Ensembl Gene ENSMUSG00000038963
Gene Name solute carrier organic anion transporter family, member 4a1
Synonyms Slc21a12, OATP-E
MMRRC Submission 041704-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock # R4439 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 180456245-180474867 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 180472662 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 549 (V549A)
Ref Sequence ENSEMBL: ENSMUSP00000046502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038225] [ENSMUST00000038259]
AlphaFold Q8K078
Predicted Effect probably benign
Transcript: ENSMUST00000038225
AA Change: V549A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000045023
Gene: ENSMUSG00000038963
AA Change: V549A

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:OATP 103 665 5.7e-168 PFAM
Pfam:MFS_1 105 496 3e-15 PFAM
Pfam:Kazal_2 512 555 1.1e-7 PFAM
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038259
AA Change: V549A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000046502
Gene: ENSMUSG00000038963
AA Change: V549A

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:OATP 101 666 2.8e-172 PFAM
Pfam:MFS_1 105 496 2.5e-15 PFAM
Pfam:Kazal_2 512 555 7.7e-8 PFAM
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139902
Meta Mutation Damage Score 0.0874 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 94% (50/53)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb C T 5: 114,246,496 T2237I possibly damaging Het
Adgre1 T A 17: 57,447,954 L684Q probably damaging Het
Cfap157 T A 2: 32,777,865 Y488F probably benign Het
D630045J12Rik A G 6: 38,194,761 I824T probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Eno2 T C 6: 124,762,959 probably benign Het
Fam78b C A 1: 167,078,922 Q217K probably damaging Het
Fpgs C T 2: 32,687,501 C219Y probably damaging Het
Garem2 G T 5: 30,113,346 V106L possibly damaging Het
Gm13084 A T 4: 143,811,573 V276E possibly damaging Het
Grk3 A T 5: 112,946,677 probably null Het
Hint2 T A 4: 43,654,919 Y70F probably damaging Het
Hist1h3b A T 13: 23,752,725 probably null Het
Ipp A G 4: 116,515,077 N101S probably benign Het
Kcnj1 A T 9: 32,394,118 probably benign Het
Kcnk4 T C 19: 6,932,761 D44G probably benign Het
Kif5c T C 2: 49,688,725 S122P possibly damaging Het
Nipbl T A 15: 8,338,724 K1171N probably damaging Het
Olfr1285 T A 2: 111,409,308 noncoding transcript Het
Pcf11 A C 7: 92,658,017 L981R probably damaging Het
Pias2 T A 18: 77,097,703 L153H probably damaging Het
Pjvk T C 2: 76,651,406 S68P probably damaging Het
Pkd1 T C 17: 24,585,692 V3130A probably damaging Het
Plpp4 C A 7: 129,257,089 probably benign Het
Plxnd1 T A 6: 115,993,976 H277L probably damaging Het
Rasgrf2 T C 13: 91,983,678 D620G possibly damaging Het
Rd3l C A 12: 111,979,658 S63I possibly damaging Het
Scfd2 G C 5: 74,397,707 A503G possibly damaging Het
Tenm4 A G 7: 96,895,815 N2375S probably benign Het
Tespa1 C T 10: 130,361,957 R283C probably damaging Het
Tle2 A G 10: 81,581,682 E227G possibly damaging Het
Tnn T G 1: 160,116,080 E1054D probably benign Het
Tnrc6a A T 7: 123,152,182 K54* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpr T A 1: 150,403,961 D206E probably benign Het
Ugt2b34 A T 5: 86,892,867 F399I probably damaging Het
Usp3 A T 9: 66,518,494 D456E probably benign Het
Vmn1r60 T A 7: 5,544,489 H204L probably damaging Het
Vmn2r97 G T 17: 18,930,354 A488S probably benign Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Wdr86 T C 5: 24,730,237 D36G probably damaging Het
Zc3h4 C T 7: 16,429,111 P479S unknown Het
Zfhx4 A T 3: 5,214,815 probably benign Het
Zfp607b T A 7: 27,702,724 C202S probably damaging Het
Zfp882 T A 8: 71,913,609 F93L probably damaging Het
Other mutations in Slco4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:Slco4a1 APN 2 180464679 missense probably damaging 1.00
IGL01982:Slco4a1 APN 2 180473153 missense probably benign 0.03
IGL02297:Slco4a1 APN 2 180464489 missense probably benign 0.16
IGL02368:Slco4a1 APN 2 180473128 missense probably damaging 0.98
conduit UTSW 2 180473615 missense probably damaging 1.00
ingress UTSW 2 180465677 missense probably benign
R1621:Slco4a1 UTSW 2 180471132 missense probably benign 0.01
R2275:Slco4a1 UTSW 2 180464736 missense possibly damaging 0.94
R2472:Slco4a1 UTSW 2 180467087 missense probably damaging 1.00
R3851:Slco4a1 UTSW 2 180464091 missense probably benign 0.00
R3852:Slco4a1 UTSW 2 180464091 missense probably benign 0.00
R4271:Slco4a1 UTSW 2 180474210 missense possibly damaging 0.85
R4571:Slco4a1 UTSW 2 180464378 missense probably benign 0.32
R4732:Slco4a1 UTSW 2 180473615 missense probably damaging 1.00
R4733:Slco4a1 UTSW 2 180473615 missense probably damaging 1.00
R4925:Slco4a1 UTSW 2 180472056 missense probably benign 0.35
R5156:Slco4a1 UTSW 2 180472779 missense probably benign 0.01
R5186:Slco4a1 UTSW 2 180473108 missense probably damaging 1.00
R5252:Slco4a1 UTSW 2 180464459 missense possibly damaging 0.48
R5426:Slco4a1 UTSW 2 180471235 missense possibly damaging 0.84
R5470:Slco4a1 UTSW 2 180474114 missense probably benign 0.00
R5512:Slco4a1 UTSW 2 180474114 missense possibly damaging 0.91
R6969:Slco4a1 UTSW 2 180464808 missense probably benign
R7133:Slco4a1 UTSW 2 180472063 missense possibly damaging 0.93
R7249:Slco4a1 UTSW 2 180464811 missense probably benign 0.01
R7357:Slco4a1 UTSW 2 180472137 missense probably benign 0.00
R7442:Slco4a1 UTSW 2 180474126 missense probably benign
R7599:Slco4a1 UTSW 2 180471255 missense probably benign
R7750:Slco4a1 UTSW 2 180471237 missense probably benign 0.30
R7834:Slco4a1 UTSW 2 180465677 missense probably benign
R8203:Slco4a1 UTSW 2 180464799 missense probably damaging 0.96
R8504:Slco4a1 UTSW 2 180464799 missense probably damaging 0.96
R9166:Slco4a1 UTSW 2 180464241 missense probably benign 0.00
R9170:Slco4a1 UTSW 2 180464685 missense probably benign 0.00
R9210:Slco4a1 UTSW 2 180472478 missense probably damaging 1.00
Z1177:Slco4a1 UTSW 2 180464381 missense possibly damaging 0.85
Z1177:Slco4a1 UTSW 2 180464564 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACGCCATCTACTGTTGCCAG -3'
(R):5'- AGAGCTTCTTACCGTAGAGTAGC -3'

Sequencing Primer
(F):5'- ATCTACTGTTGCCAGCCGAAG -3'
(R):5'- CTTACCGTAGAGTAGCAGTTAGC -3'
Posted On 2016-03-10