Mutagenetix > Incidental Mutations

Incidental Mutation 'R4551:Cpd'

374421

Institutional Source

Beutler Lab

Gene Symbol

Cpd

Ensembl Gene

ENSMUSG00000020841

Gene Name

carboxypeptidase D

Synonyms

D830034L15Rik

MMRRC Submission

041782-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.930) question?

Stock #

R4551 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

76778424-76847018 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 76811886 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 552 (G552D)

Ref Sequence

ENSEMBL: ENSMUSP00000021201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021201]

Predicted Effect

probably damaging
Transcript: ENSMUST00000021201
AA Change: G552D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021201
Gene: ENSMUSG00000020841
AA Change: G552D

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Zn_pept	62	471	1.71e-52	SMART
Zn_pept	502	900	2.11e-66	SMART
Zn_pept	930	1195	1.11e-42	SMART
Pfam:CarboxypepD_reg	1211	1284	3.6e-10	PFAM
transmembrane domain	1297	1319	N/A	INTRINSIC
low complexity region	1363	1371	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132796

Meta Mutation Damage Score

0.4975

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The metallocarboxypeptidase family of enzymes is divided into 2 subfamilies based on sequence similarities. The pancreatic carboxypeptidase-like and the regulatory B-type carboxypeptidase subfamilies. Carboxypeptidase D has been identified as a regulatory B-type carboxypeptidase. CPD is a homolog of duck gp180, a hepatitis B virus-binding protein. Transcript variants utilizing alternative polyadenylation signals exist for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	T	G	11: 120,011,569	E610A	probably benign	Het
Abhd17b	T	C	19: 21,680,926	S176P	possibly damaging	Het
Adgrg7	A	G	16: 56,748,012	Y427H	probably damaging	Het
Alox15	T	A	11: 70,344,596	I647L	probably benign	Het
Ankhd1	C	A	18: 36,655,507		probably null	Het
Arid1a	A	C	4: 133,695,699		probably benign	Het
Armcx5	T	A	X: 135,746,507	V444D	probably damaging	Het
C4bp	A	G	1: 130,636,727	Y407H	possibly damaging	Het
Cog6	T	A	3: 52,998,320	E96V	probably damaging	Het
Cox20	A	C	1: 178,322,549	N96T	probably benign	Het
Cpa3	T	C	3: 20,219,770	I351V	probably benign	Het
Cyld	A	G	8: 88,707,134	K184E	possibly damaging	Het
Dab2	G	A	15: 6,435,294	G324D	probably damaging	Het
Depdc1a	T	A	3: 159,522,584	D324E	probably damaging	Het
Dnah9	T	C	11: 65,841,366	E4238G	probably damaging	Het
Dync1i1	T	A	6: 5,923,206	D275E	probably benign	Het
Epgn	A	T	5: 91,027,562	K14*	probably null	Het
Farp2	T	A	1: 93,618,592	L868Q	possibly damaging	Het
Gpr45	A	G	1: 43,032,790	T198A	probably benign	Het
Grk2	C	T	19: 4,286,056	V402M	possibly damaging	Het
Gsap	A	T	5: 21,290,571	D79V	probably damaging	Het
Gtf2h3	A	G	5: 124,590,419		probably benign	Het
Hus1b	C	A	13: 30,947,076	S200I	probably damaging	Het
Hypk	A	G	2: 121,453,480		probably null	Het
Ikbke	T	C	1: 131,258,033		probably benign	Het
Kat6b	A	G	14: 21,661,448	E670G	probably damaging	Het
Kif26b	T	A	1: 178,884,035	I740N	probably damaging	Het
Lhx3	G	A	2: 26,201,190	P369L	probably damaging	Het
Man2c1	T	C	9: 57,131,161	L35P	probably damaging	Het
Micalcl	T	A	7: 112,381,916	S366T	possibly damaging	Het
Mroh9	A	T	1: 163,044,093	I607N	probably damaging	Het
Mybphl	T	C	3: 108,374,163	I65T	possibly damaging	Het
Myo1g	A	G	11: 6,517,874	I187T	probably damaging	Het
Myo7b	T	C	18: 31,985,108	S822G	probably benign	Het
Nkx2-4	C	A	2: 147,084,922	A142S	probably benign	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Odf4	C	T	11: 68,922,040	S264N	probably benign	Het
Olfr360	G	T	2: 37,068,343	V13L	probably benign	Het
Olfr45	A	T	7: 140,691,742	Y279F	probably damaging	Het
Olfr657	A	T	7: 104,636,424	H250L	probably damaging	Het
Papolb	T	C	5: 142,529,178	I237V	probably benign	Het
Parpbp	T	A	10: 88,093,702	Q428L	possibly damaging	Het
Pcdhb16	T	C	18: 37,479,834	F616L	probably damaging	Het
Pdk3	A	T	X: 93,782,240	M253K	probably damaging	Het
Pgap2	C	A	7: 102,226,467		probably benign	Het
Pkhd1l1	C	A	15: 44,550,885	N2849K	probably damaging	Het
Pprc1	A	G	19: 46,067,225		probably benign	Het
Psma2	A	G	13: 14,616,845	Y25C	possibly damaging	Het
Ptgir	A	G	7: 16,906,869	M29V	possibly damaging	Het
Ptpn5	C	A	7: 47,090,852		probably benign	Het
Pxn	G	T	5: 115,552,720		probably benign	Het
Scd3	C	A	19: 44,215,439	A22E	probably benign	Het
Sdr42e1	T	C	8: 117,663,608	E98G	probably benign	Het
Slc14a2	A	C	18: 78,195,853	S184A	probably benign	Het
Tmem236	A	T	2: 14,219,153	Q251L	probably benign	Het
Trappc8	T	C	18: 20,874,672	T129A	probably benign	Het
Vmn1r90	A	C	7: 14,561,969	M68R	possibly damaging	Het
Vmn2r105	A	G	17: 20,226,351	V462A	probably benign	Het
Vmn2r7	T	C	3: 64,690,689	T816A	possibly damaging	Het
Vmn2r81	T	A	10: 79,268,407	I288K	possibly damaging	Het
Zfp180	A	C	7: 24,104,573	K139T	possibly damaging	Het
Zfp932	T	C	5: 110,009,639	V401A	probably benign	Het

Other mutations in Cpd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:Cpd	APN	11	76797789	missense	probably benign	0.00
IGL00698:Cpd	APN	11	76840444	missense	possibly damaging	0.82
IGL01025:Cpd	APN	11	76795613	missense	probably damaging	1.00
IGL01292:Cpd	APN	11	76846245	missense	possibly damaging	0.80
IGL01571:Cpd	APN	11	76782296	missense	probably damaging	1.00
IGL01606:Cpd	APN	11	76812640	missense	probably benign
IGL02283:Cpd	APN	11	76840425	missense	probably benign	0.19
IGL02895:Cpd	APN	11	76785203	missense	probably benign	0.06
IGL02965:Cpd	APN	11	76790988	splice site	probably benign
IGL03116:Cpd	APN	11	76811713	missense	probably damaging	1.00
IGL03178:Cpd	APN	11	76806051	missense	probably benign	0.02
PIT4280001:Cpd	UTSW	11	76791024	missense	probably benign	0.23
PIT4382001:Cpd	UTSW	11	76797788	missense	probably benign
R0050:Cpd	UTSW	11	76792859	missense	possibly damaging	0.94
R0054:Cpd	UTSW	11	76790838	missense	probably damaging	1.00
R0054:Cpd	UTSW	11	76790838	missense	probably damaging	1.00
R0320:Cpd	UTSW	11	76840447	missense	possibly damaging	0.50
R0416:Cpd	UTSW	11	76785204	missense	probably benign	0.13
R0556:Cpd	UTSW	11	76802345	splice site	probably benign
R0666:Cpd	UTSW	11	76782327	missense	probably damaging	1.00
R0668:Cpd	UTSW	11	76784398	missense	probably damaging	1.00
R1180:Cpd	UTSW	11	76801753	missense	possibly damaging	0.56
R1472:Cpd	UTSW	11	76784398	missense	probably damaging	0.98
R1518:Cpd	UTSW	11	76840386	critical splice donor site	probably null
R1617:Cpd	UTSW	11	76846669	missense	probably damaging	1.00
R1786:Cpd	UTSW	11	76792798	missense	probably benign	0.00
R1854:Cpd	UTSW	11	76786338	missense	probably damaging	1.00
R1861:Cpd	UTSW	11	76784382	splice site	probably benign
R2159:Cpd	UTSW	11	76797641	missense	probably damaging	0.96
R2205:Cpd	UTSW	11	76802244	missense	probably damaging	0.99
R2281:Cpd	UTSW	11	76797801	missense	probably benign	0.00
R2680:Cpd	UTSW	11	76790999	missense	probably benign
R2928:Cpd	UTSW	11	76846374	missense	probably benign
R2937:Cpd	UTSW	11	76811859	missense	probably damaging	1.00
R4133:Cpd	UTSW	11	76814818	nonsense	probably null
R4241:Cpd	UTSW	11	76846785	missense	probably benign	0.03
R4369:Cpd	UTSW	11	76797711	missense	possibly damaging	0.82
R4538:Cpd	UTSW	11	76790999	missense	probably benign
R4617:Cpd	UTSW	11	76840615	missense	probably damaging	1.00
R4732:Cpd	UTSW	11	76811794	missense	probably damaging	0.99
R4733:Cpd	UTSW	11	76811794	missense	probably damaging	0.99
R4821:Cpd	UTSW	11	76846237	missense	probably benign	0.38
R4852:Cpd	UTSW	11	76785150	missense	probably benign	0.32
R4901:Cpd	UTSW	11	76790881	missense	probably damaging	1.00
R4988:Cpd	UTSW	11	76814830	missense	probably damaging	0.98
R4999:Cpd	UTSW	11	76846222	critical splice donor site	probably null
R5005:Cpd	UTSW	11	76813570	missense	probably damaging	1.00
R5092:Cpd	UTSW	11	76811704	missense	possibly damaging	0.75
R5438:Cpd	UTSW	11	76791966	missense	possibly damaging	0.65
R5524:Cpd	UTSW	11	76797901	nonsense	probably null
R5677:Cpd	UTSW	11	76799825	missense	probably benign
R5826:Cpd	UTSW	11	76784416	nonsense	probably null
R6031:Cpd	UTSW	11	76790888	missense	probably benign	0.00
R6031:Cpd	UTSW	11	76790888	missense	probably benign	0.00
R6103:Cpd	UTSW	11	76799799	missense	probably benign	0.00
R6257:Cpd	UTSW	11	76812670	missense	probably benign	0.37
R6263:Cpd	UTSW	11	76846271	missense	probably benign	0.00
R6485:Cpd	UTSW	11	76808707	splice site	probably null
R6671:Cpd	UTSW	11	76795533	missense	probably damaging	1.00
R6995:Cpd	UTSW	11	76785055	missense	probably benign	0.02
R7074:Cpd	UTSW	11	76813594	missense	probably damaging	1.00
R7192:Cpd	UTSW	11	76814841	missense	probably damaging	1.00
R7341:Cpd	UTSW	11	76846953	missense	unknown
R7371:Cpd	UTSW	11	76846611	missense	probably benign	0.25
R7380:Cpd	UTSW	11	76802325	nonsense	probably null
R7392:Cpd	UTSW	11	76801779	missense	probably damaging	1.00
R7410:Cpd	UTSW	11	76782308	missense	probably damaging	1.00
R7509:Cpd	UTSW	11	76797876	missense	probably benign	0.17
R7767:Cpd	UTSW	11	76813559	missense	probably benign	0.03
Z1088:Cpd	UTSW	11	76801746	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACCAACATATTAGGCTGTCTCTTC -3'
(R):5'- CCTGCTCAGACATGTGTACTG -3'

Sequencing Primer
(F):5'- TGGGACTTTTCATATCCATCAGG -3'
(R):5'- GCTCAGACATGTGTACTGATTAAAAG -3'

Posted On

2016-03-11