Mutagenetix > Incidental Mutation

Incidental Mutation 'R4825:Spta1'

374433

Institutional Source

Beutler Lab

Gene Symbol

Spta1

Ensembl Gene

ENSMUSG00000026532

Gene Name

spectrin alpha, erythrocytic 1

Synonyms

erythroid, Spna-1, ihj, Spna1

MMRRC Submission

042441-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.912) question?

Stock #

R4825 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

174172776-174248450 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to T at 174244042 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000027817 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027817] [ENSMUST00000027817] [ENSMUST00000214725]

AlphaFold

P08032

Predicted Effect

probably null
Transcript: ENSMUST00000027817

SMART Domains

Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532

Domain	Start	End	E-Value	Type
SPEC	55	153	3.62e-11	SMART
SPEC	159	259	1.84e-26	SMART
SPEC	265	365	1.56e-24	SMART
SPEC	371	471	8.35e-25	SMART
SPEC	477	577	1.19e-29	SMART
SPEC	583	682	2.43e-26	SMART
SPEC	688	788	1.3e-26	SMART
SPEC	794	894	1.66e-28	SMART
SPEC	900	1077	5.03e-19	SMART
SH3	978	1033	2.98e-15	SMART
SPEC	1083	1178	2.57e-16	SMART
SPEC	1184	1284	1.15e-27	SMART
SPEC	1290	1390	7.05e-23	SMART
SPEC	1396	1495	6.04e-22	SMART
SPEC	1501	1602	1.15e-27	SMART
SPEC	1608	1708	5.46e-29	SMART
SPEC	1714	1814	1.08e-32	SMART
SPEC	1820	1921	2.17e-23	SMART
SPEC	1927	2028	2.19e-19	SMART
SPEC	2042	2142	3.87e-11	SMART
SPEC	2156	2253	9.77e-8	SMART
low complexity region	2307	2318	N/A	INTRINSIC
efhand_Ca_insen	2346	2414	2.37e-27	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000027817

SMART Domains

Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532

Domain	Start	End	E-Value	Type
SPEC	55	153	3.62e-11	SMART
SPEC	159	259	1.84e-26	SMART
SPEC	265	365	1.56e-24	SMART
SPEC	371	471	8.35e-25	SMART
SPEC	477	577	1.19e-29	SMART
SPEC	583	682	2.43e-26	SMART
SPEC	688	788	1.3e-26	SMART
SPEC	794	894	1.66e-28	SMART
SPEC	900	1077	5.03e-19	SMART
SH3	978	1033	2.98e-15	SMART
SPEC	1083	1178	2.57e-16	SMART
SPEC	1184	1284	1.15e-27	SMART
SPEC	1290	1390	7.05e-23	SMART
SPEC	1396	1495	6.04e-22	SMART
SPEC	1501	1602	1.15e-27	SMART
SPEC	1608	1708	5.46e-29	SMART
SPEC	1714	1814	1.08e-32	SMART
SPEC	1820	1921	2.17e-23	SMART
SPEC	1927	2028	2.19e-19	SMART
SPEC	2042	2142	3.87e-11	SMART
SPEC	2156	2253	9.77e-8	SMART
low complexity region	2307	2318	N/A	INTRINSIC
efhand_Ca_insen	2346	2414	2.37e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156092

Predicted Effect

probably benign
Transcript: ENSMUST00000214725

Meta Mutation Damage Score

0.9491

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is a tetramer made up of alpha-beta dimers linked in a head-to-head arrangement. This gene is one member of a family of alpha-spectrin genes. The encoded protein is primarily composed of 22 spectrin repeats which are involved in dimer formation. It forms weaker tetramer interactions than non-erythrocytic alpha spectrin, which may increase the plasma membrane elasticity and deformability of red blood cells. Mutations in this gene result in a variety of hereditary red blood cell disorders, including elliptocytosis type 2, pyropoikilocytosis, and spherocytic hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit microcytic, hypochromic, hemolytic anemia, jaundice, and high neonatal mortality. Heterozygotes of some alleles may exhibit a mild spherocytic transition. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 130 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	C	A	11: 109,791,672	L229F	probably benign	Het
A930002H24Rik	A	C	17: 63,863,608	S62A	unknown	Het
Abca12	T	A	1: 71,302,685	Q1039L	possibly damaging	Het
Adgrg5	T	A	8: 94,941,734	F476I	possibly damaging	Het
AI314180	G	A	4: 58,850,911	L421F	probably damaging	Het
Alms1	A	G	6: 85,678,245	K2789E	probably damaging	Het
Arrdc2	G	A	8: 70,839,277		probably null	Het
Atp2b1	T	A	10: 99,009,564	I743K	probably damaging	Het
Atp6v1c2	C	T	12: 17,289,060	G230D	probably benign	Het
AU040320	G	A	4: 126,791,793	C54Y	probably damaging	Het
BC024139	C	T	15: 76,120,317	V680I	possibly damaging	Het
Bckdhb	A	G	9: 83,988,905	D156G	probably damaging	Het
Canx	T	A	11: 50,308,809	D143V	probably benign	Het
Ccdc180	T	A	4: 45,912,794	V591E	possibly damaging	Het
Ccno	T	C	13: 112,988,099	S68P	probably benign	Het
Cdc45	C	T	16: 18,784,863	E527K	probably damaging	Het
Cep290	T	A	10: 100,488,348	D14E	probably damaging	Het
Cgnl1	A	G	9: 71,630,524	V1238A	probably benign	Het
Ciz1	C	T	2: 32,371,741	A455V	probably damaging	Het
Coro2b	T	A	9: 62,454,623	Y86F	probably benign	Het
Csf2ra	C	T	19: 61,226,552	R158Q	probably benign	Het
Cubn	A	T	2: 13,325,225	I2615N	probably damaging	Het
Dhx8	C	T	11: 101,738,170	R129*	probably null	Het
Disc1	T	A	8: 125,135,302	M471K	possibly damaging	Het
Dmxl2	G	T	9: 54,404,041	L1799I	probably benign	Het
Dnah2	A	G	11: 69,423,205	S4108P	probably damaging	Het
Ehmt2	C	G	17: 34,906,964	P211R	probably benign	Het
Eif4g3	A	G	4: 138,194,081	D1557G	probably benign	Het
Epha5	T	C	5: 84,233,840	D384G	probably damaging	Het
Etl4	A	G	2: 20,806,927	I1274V	probably damaging	Het
Fam160a1	G	A	3: 85,673,432	P489S	possibly damaging	Het
Fip1l1	G	A	5: 74,588,205		probably null	Het
Fubp1	T	C	3: 152,217,890		probably null	Het
Glul	T	C	1: 153,903,044	V33A	probably benign	Het
Gm4846	A	G	1: 166,491,668	F167S	probably damaging	Het
Heatr6	T	A	11: 83,758,322	L168M	probably damaging	Het
Hif1a	T	A	12: 73,932,401	I233N	probably damaging	Het
Hivep2	T	A	10: 14,131,319	H1220Q	possibly damaging	Het
Igkv8-21	T	C	6: 70,315,426	I9M	probably benign	Het
Izumo1	T	A	7: 45,624,987	C62*	probably null	Het
Jakmip3	G	A	7: 139,026,766	E424K	probably damaging	Het
Klhl2	A	G	8: 64,752,813	V358A	probably damaging	Het
Klk10	C	G	7: 43,783,598	D139E	probably damaging	Het
Klk14	T	C	7: 43,692,076	C51R	probably damaging	Het
Klk5	T	G	7: 43,845,390	I99S	probably damaging	Het
L3hypdh	T	C	12: 72,077,393	T258A	probably benign	Het
Lrp5	A	G	19: 3,614,292	Y812H	probably damaging	Het
Lrrc40	T	A	3: 158,061,330	L474*	probably null	Het
Mkks	A	T	2: 136,880,655	M194K	probably benign	Het
Mmp20	A	G	9: 7,654,120	D347G	probably damaging	Het
Mmp27	A	G	9: 7,581,194	E460G	probably damaging	Het
Mms22l	T	C	4: 24,536,226	F605S	probably damaging	Het
Mpzl3	A	G	9: 45,068,329	S193G	probably benign	Het
Muc4	A	T	16: 32,751,747	T542S	probably benign	Het
Muc5b	T	C	7: 141,868,465	L4446P	possibly damaging	Het
Mxi1	C	A	19: 53,370,338	S131*	probably null	Het
Nanog	G	T	6: 122,713,340	A210S	probably benign	Het
Nrcam	C	T	12: 44,575,986	Q988*	probably null	Het
Nsg1	C	A	5: 38,159,047		probably benign	Het
Ogfod3	G	A	11: 121,195,201	A189V	probably benign	Het
Olfr1121	T	A	2: 87,372,088	C185*	probably null	Het
Olfr1228	T	C	2: 89,248,690		probably null	Het
Olfr1240	A	G	2: 89,439,865	V138A	probably benign	Het
Olfr1260	G	A	2: 89,978,153	C125Y	probably damaging	Het
Olfr1465	A	T	19: 13,314,320		probably null	Het
Olfr548-ps1	T	A	7: 102,542,380	V148E	possibly damaging	Het
Olfr58	T	G	9: 19,783,576	S148A	possibly damaging	Het
Olfr632	T	C	7: 103,937,503	V41A	probably benign	Het
Olfr920	A	T	9: 38,756,407	T240S	probably damaging	Het
Olfr980	A	T	9: 40,006,742	M69K	possibly damaging	Het
Orc3	A	T	4: 34,571,774	M665K	possibly damaging	Het
Pabpc1	A	G	15: 36,597,011	S591P	probably damaging	Het
Parp6	T	A	9: 59,624,362		probably null	Het
Pcdh1	T	C	18: 38,189,859	M974V	possibly damaging	Het
Pcdhb22	T	A	18: 37,520,660	V727E	possibly damaging	Het
Pex5l	T	C	3: 32,992,985	E272G	probably damaging	Het
Pglyrp2	G	T	17: 32,418,261	N264K	probably benign	Het
Phxr4	T	A	9: 13,431,586		probably benign	Het
Piezo2	A	G	18: 63,144,954	F293S	probably damaging	Het
Pkhd1	T	C	1: 20,537,401	D1077G	probably damaging	Het
Plekhs1	A	G	19: 56,473,268		probably null	Het
Prex1	G	T	2: 166,585,857	C788*	probably null	Het
Prrt3	A	T	6: 113,498,138	M41K	probably benign	Het
Ptgir	T	C	7: 16,908,843	V326A	probably damaging	Het
Ptprg	T	A	14: 12,220,654	D455E	probably damaging	Het
Ptpru	T	A	4: 131,799,603	Q686L	probably benign	Het
Pxdc1	G	T	13: 34,630,360	T190K	probably benign	Het
Rap1b	A	T	10: 117,818,582	C118S	probably benign	Het
Rapgef2	T	C	3: 79,083,227	M915V	probably benign	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rpe65	C	T	3: 159,624,681	A495V	probably benign	Het
Samd15	A	G	12: 87,200,834	T98A	possibly damaging	Het
Sdk1	T	G	5: 141,582,294	D82E	probably benign	Het
Slc26a7	T	C	4: 14,546,309	D340G	probably benign	Het
Slc6a15	T	A	10: 103,418,060	M619K	probably benign	Het
Slc7a4	C	A	16: 17,574,521	D350Y	probably damaging	Het
Slk	T	G	19: 47,619,956	N449K	probably benign	Het
Sptbn5	A	T	2: 120,055,893		probably benign	Het
Srd5a2	A	T	17: 74,047,805	V8D	probably benign	Het
Srgap3	G	A	6: 112,727,310	A906V	probably benign	Het
Stab2	A	T	10: 86,947,147	M679K	probably benign	Het
Stk3	T	C	15: 34,999,908	I291V	probably benign	Het
Supt6	T	A	11: 78,208,134	Q1637L	possibly damaging	Het
Svil	T	C	18: 5,114,564	F2047S	probably damaging	Het
Swsap1	A	G	9: 21,955,988	E76G	probably benign	Het
Syndig1	G	T	2: 149,899,553	G20C	probably damaging	Het
Synj2bp	A	T	12: 81,502,152	N104K	probably damaging	Het
Synpo2	T	A	3: 123,114,419	D416V	probably damaging	Het
Tacc3	G	T	5: 33,672,013	C620F	probably damaging	Het
Tanc1	A	G	2: 59,699,422	E19G	probably damaging	Het
Tarsl2	C	T	7: 65,647,554	A139V	probably benign	Het
Tbc1d22a	T	A	15: 86,351,734	C365S	probably damaging	Het
Tdpoz2	T	C	3: 93,652,074	H197R	possibly damaging	Het
Tha1	A	T	11: 117,869,379	N300K	probably damaging	Het
Tm6sf1	T	A	7: 81,865,260	F70L	probably damaging	Het
Tmem132b	T	A	5: 125,783,433	S581T	probably benign	Het
Tmem206	A	T	1: 191,340,843	I154F	probably damaging	Het
Tnfsf13	G	T	11: 69,685,249	S4*	probably null	Het
Tonsl	G	A	15: 76,633,248	S757L	probably benign	Het
Trem2	G	T	17: 48,351,691	R161S	possibly damaging	Het
Trpm2	A	T	10: 77,941,173	V430E	probably damaging	Het
Ttc14	T	A	3: 33,801,369	D154E	possibly damaging	Het
Ugt2b37	T	C	5: 87,250,639	M313V	possibly damaging	Het
Uhrf1bp1	G	A	17: 27,877,394	A107T	probably damaging	Het
Vmn2r24	A	G	6: 123,815,780	I689V	probably benign	Het
Wdr76	A	G	2: 121,542,494	T601A	probably benign	Het
Xirp1	T	C	9: 120,017,003	D938G	possibly damaging	Het
Zfp608	A	T	18: 54,897,969	D966E	probably benign	Het
Zfp957	A	G	14: 79,214,356	M1T	probably null	Het
Zkscan16	A	T	4: 58,957,809	H697L	possibly damaging	Het

Other mutations in Spta1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Spta1	APN	1	174208390	nonsense	probably null
IGL01095:Spta1	APN	1	174213485	missense	probably benign	0.02
IGL01144:Spta1	APN	1	174187263	missense	probably benign	0.05
IGL01455:Spta1	APN	1	174203311	missense	possibly damaging	0.78
IGL01541:Spta1	APN	1	174217159	missense	probably benign	0.03
IGL01613:Spta1	APN	1	174208394	missense	probably damaging	1.00
IGL01804:Spta1	APN	1	174244180	missense	probably benign	0.42
IGL01859:Spta1	APN	1	174174372	missense	probably damaging	1.00
IGL01898:Spta1	APN	1	174213862	missense	probably benign	0.00
IGL02106:Spta1	APN	1	174203294	missense	probably benign	0.02
IGL02166:Spta1	APN	1	174190231	missense	probably damaging	1.00
IGL02224:Spta1	APN	1	174217689	critical splice donor site	probably benign
IGL02318:Spta1	APN	1	174174463	missense	possibly damaging	0.51
IGL02392:Spta1	APN	1	174218814	missense	probably damaging	0.96
IGL02852:Spta1	APN	1	174244110	missense	probably benign	0.24
IGL02861:Spta1	APN	1	174211598	missense	probably damaging	1.00
IGL02982:Spta1	APN	1	174187288	missense	probably benign	0.00
IGL03057:Spta1	APN	1	174181058	missense	probably benign	0.19
IGL03215:Spta1	APN	1	174218743	missense	probably damaging	1.00
IGL03263:Spta1	APN	1	174213918	missense	probably damaging	0.99
IGL03272:Spta1	APN	1	174214144	missense	probably benign	0.08
bounced	UTSW	1	174224457	missense	probably damaging	1.00
Capillus	UTSW	1	174217688	critical splice donor site	probably null
Deflection	UTSW	1	174241087	missense	probably damaging	1.00
Goldfoil	UTSW	1	174218512	missense	probably damaging	1.00
hanging	UTSW	1	174178749	missense	probably damaging	0.99
Klimt	UTSW	1	174202386	missense	probably damaging	1.00
Rutherford	UTSW	1	174207110	missense	probably null	1.00
Thread	UTSW	1	174197635	nonsense	probably null
H8786:Spta1	UTSW	1	174179839	missense	probably damaging	0.98
R0003:Spta1	UTSW	1	174205273	missense	probably damaging	0.98
R0003:Spta1	UTSW	1	174205273	missense	probably damaging	0.98
R0010:Spta1	UTSW	1	174217943	missense	probably benign	0.03
R0010:Spta1	UTSW	1	174217943	missense	probably benign	0.03
R0078:Spta1	UTSW	1	174207032	splice site	probably benign
R0172:Spta1	UTSW	1	174230786	missense	probably damaging	1.00
R0206:Spta1	UTSW	1	174192960	missense	probably damaging	1.00
R0208:Spta1	UTSW	1	174192960	missense	probably damaging	1.00
R0276:Spta1	UTSW	1	174217894	missense	probably damaging	1.00
R0288:Spta1	UTSW	1	174243179	missense	probably damaging	0.99
R0323:Spta1	UTSW	1	174218451	missense	probably damaging	1.00
R0454:Spta1	UTSW	1	174213942	missense	probably damaging	1.00
R0508:Spta1	UTSW	1	174224457	missense	probably damaging	1.00
R0698:Spta1	UTSW	1	174181104	missense	probably damaging	1.00
R0751:Spta1	UTSW	1	174184690	missense	probably damaging	1.00
R0925:Spta1	UTSW	1	174174426	missense	possibly damaging	0.85
R0941:Spta1	UTSW	1	174245205	unclassified	probably benign
R1131:Spta1	UTSW	1	174185647	missense	probably damaging	1.00
R1171:Spta1	UTSW	1	174211614	nonsense	probably null
R1184:Spta1	UTSW	1	174184690	missense	probably damaging	1.00
R1401:Spta1	UTSW	1	174222684	missense	probably damaging	1.00
R1489:Spta1	UTSW	1	174231325	missense	probably damaging	0.97
R1532:Spta1	UTSW	1	174247353	missense	probably damaging	0.99
R1551:Spta1	UTSW	1	174240166	missense	possibly damaging	0.94
R1555:Spta1	UTSW	1	174178749	missense	probably damaging	0.99
R1566:Spta1	UTSW	1	174184706	missense	probably benign	0.00
R1586:Spta1	UTSW	1	174213495	missense	probably benign	0.00
R1676:Spta1	UTSW	1	174179839	missense	probably damaging	0.98
R1711:Spta1	UTSW	1	174241042	missense	probably damaging	1.00
R1795:Spta1	UTSW	1	174245730	missense	probably damaging	1.00
R1823:Spta1	UTSW	1	174246549	missense	probably benign	0.05
R1842:Spta1	UTSW	1	174195947	missense	probably benign	0.00
R1867:Spta1	UTSW	1	174219839	missense	probably benign	0.33
R1970:Spta1	UTSW	1	174240367	missense	possibly damaging	0.88
R2042:Spta1	UTSW	1	174211647	missense	probably benign	0.20
R2095:Spta1	UTSW	1	174244198	missense	possibly damaging	0.75
R2125:Spta1	UTSW	1	174208344	missense	possibly damaging	0.80
R2145:Spta1	UTSW	1	174212614	missense	probably benign	0.00
R2158:Spta1	UTSW	1	174229258	missense	probably benign	0.41
R2187:Spta1	UTSW	1	174192966	missense	probably damaging	1.00
R2250:Spta1	UTSW	1	174244114	missense	probably damaging	1.00
R2258:Spta1	UTSW	1	174174341	missense	possibly damaging	0.76
R2319:Spta1	UTSW	1	174178656	critical splice acceptor site	probably null
R3782:Spta1	UTSW	1	174208314	missense	probably damaging	1.00
R4058:Spta1	UTSW	1	174241137	missense	probably damaging	1.00
R4080:Spta1	UTSW	1	174214066	missense	probably benign	0.00
R4081:Spta1	UTSW	1	174214066	missense	probably benign	0.00
R4082:Spta1	UTSW	1	174214066	missense	probably benign	0.00
R4108:Spta1	UTSW	1	174174556	missense	probably benign	0.01
R4115:Spta1	UTSW	1	174240357	missense	probably damaging	1.00
R4303:Spta1	UTSW	1	174179852	missense	probably damaging	1.00
R4419:Spta1	UTSW	1	174247424	nonsense	probably null
R4525:Spta1	UTSW	1	174207110	missense	probably null	1.00
R4614:Spta1	UTSW	1	174192977	missense	probably damaging	1.00
R4673:Spta1	UTSW	1	174191062	splice site	probably null
R4782:Spta1	UTSW	1	174230666	missense	probably benign	0.01
R4829:Spta1	UTSW	1	174237927	missense	probably benign	0.01
R4873:Spta1	UTSW	1	174175830	missense	probably damaging	1.00
R4875:Spta1	UTSW	1	174175830	missense	probably damaging	1.00
R4898:Spta1	UTSW	1	174237834	missense	possibly damaging	0.94
R4910:Spta1	UTSW	1	174217863	splice site	probably null
R4911:Spta1	UTSW	1	174185647	missense	probably damaging	1.00
R4928:Spta1	UTSW	1	174191056	missense	probably benign	0.15
R4959:Spta1	UTSW	1	174246608	missense	probably damaging	0.97
R5009:Spta1	UTSW	1	174240223	missense	possibly damaging	0.62
R5149:Spta1	UTSW	1	174247434	missense	probably damaging	0.99
R5293:Spta1	UTSW	1	174195985	missense	probably damaging	0.99
R5421:Spta1	UTSW	1	174215529	missense	probably damaging	0.99
R5457:Spta1	UTSW	1	174217193	missense	probably damaging	1.00
R5590:Spta1	UTSW	1	174175770	missense	possibly damaging	0.73
R5606:Spta1	UTSW	1	174219902	missense	probably damaging	1.00
R5736:Spta1	UTSW	1	174214255	critical splice donor site	probably null
R5834:Spta1	UTSW	1	174184797	splice site	probably null
R5845:Spta1	UTSW	1	174241096	missense	probably damaging	0.97
R5987:Spta1	UTSW	1	174223328	missense	probably damaging	1.00
R6102:Spta1	UTSW	1	174224520	missense	probably benign	0.01
R6221:Spta1	UTSW	1	174181776	missense	probably damaging	1.00
R6276:Spta1	UTSW	1	174218512	missense	probably damaging	1.00
R6317:Spta1	UTSW	1	174241087	missense	probably damaging	1.00
R6329:Spta1	UTSW	1	174214177	missense	possibly damaging	0.60
R6352:Spta1	UTSW	1	174211646	missense	possibly damaging	0.94
R6374:Spta1	UTSW	1	174214168	missense	probably damaging	1.00
R6376:Spta1	UTSW	1	174203322	missense	probably benign
R6387:Spta1	UTSW	1	174231333	missense	probably benign	0.01
R6451:Spta1	UTSW	1	174217201	missense	probably damaging	0.97
R6480:Spta1	UTSW	1	174187148	splice site	probably null
R6533:Spta1	UTSW	1	174244147	missense	probably damaging	1.00
R6585:Spta1	UTSW	1	174178685	missense	probably damaging	1.00
R6695:Spta1	UTSW	1	174244042	critical splice acceptor site	probably null
R6945:Spta1	UTSW	1	174209325	missense	possibly damaging	0.89
R7020:Spta1	UTSW	1	174209352	missense	probably damaging	1.00
R7086:Spta1	UTSW	1	174199484	missense	probably damaging	0.98
R7087:Spta1	UTSW	1	174174510	missense	probably benign
R7151:Spta1	UTSW	1	174197751	missense	probably damaging	1.00
R7193:Spta1	UTSW	1	174184612	missense	probably damaging	1.00
R7199:Spta1	UTSW	1	174223271	missense	possibly damaging	0.61
R7219:Spta1	UTSW	1	174222637	missense	probably damaging	0.96
R7343:Spta1	UTSW	1	174223349	missense	probably damaging	0.99
R7372:Spta1	UTSW	1	174197635	nonsense	probably null
R7472:Spta1	UTSW	1	174246499	missense	probably damaging	1.00
R7516:Spta1	UTSW	1	174197783	missense	probably damaging	1.00
R7627:Spta1	UTSW	1	174205378	missense	probably damaging	1.00
R7770:Spta1	UTSW	1	174195981	nonsense	probably null
R7784:Spta1	UTSW	1	174202451	missense	probably damaging	1.00
R7804:Spta1	UTSW	1	174195905	missense	possibly damaging	0.50
R7854:Spta1	UTSW	1	174218830	critical splice donor site	probably null
R7862:Spta1	UTSW	1	174197785	critical splice donor site	probably null
R7958:Spta1	UTSW	1	174174390	missense	probably benign	0.03
R8015:Spta1	UTSW	1	174240171	missense	probably damaging	1.00
R8059:Spta1	UTSW	1	174218370	intron	probably benign
R8076:Spta1	UTSW	1	174187231	missense	probably benign	0.00
R8152:Spta1	UTSW	1	174217944	missense	probably benign	0.03
R8235:Spta1	UTSW	1	174202386	missense	probably damaging	1.00
R8284:Spta1	UTSW	1	174179821	missense	probably benign	0.00
R8298:Spta1	UTSW	1	174247387	missense	probably damaging	1.00
R8312:Spta1	UTSW	1	174240211	missense	probably damaging	1.00
R8495:Spta1	UTSW	1	174215485	missense	probably benign	0.00
R8550:Spta1	UTSW	1	174187208	missense	probably damaging	1.00
R8675:Spta1	UTSW	1	174230683	missense	probably benign	0.01
R8757:Spta1	UTSW	1	174213374	missense	probably damaging	1.00
R8759:Spta1	UTSW	1	174213374	missense	probably damaging	1.00
R8848:Spta1	UTSW	1	174197744	missense	probably benign	0.05
R8883:Spta1	UTSW	1	174193579	missense	possibly damaging	0.82
R8884:Spta1	UTSW	1	174217688	critical splice donor site	probably null
R8896:Spta1	UTSW	1	174217982	missense	probably damaging	1.00
R8953:Spta1	UTSW	1	174230675	missense	probably benign	0.10
R9006:Spta1	UTSW	1	174219971	missense	probably damaging	1.00
R9013:Spta1	UTSW	1	174222608	missense	probably damaging	1.00
R9077:Spta1	UTSW	1	174217604	missense	probably damaging	1.00
R9129:Spta1	UTSW	1	174231345	missense	possibly damaging	0.77
R9207:Spta1	UTSW	1	174211573	missense	probably benign	0.01
R9229:Spta1	UTSW	1	174240184	missense	probably damaging	1.00
R9281:Spta1	UTSW	1	174219878	missense	probably damaging	1.00
R9290:Spta1	UTSW	1	174217638	missense	possibly damaging	0.94
R9307:Spta1	UTSW	1	174208412	missense	probably damaging	1.00
R9489:Spta1	UTSW	1	174208314	missense	probably damaging	1.00
R9605:Spta1	UTSW	1	174208314	missense	probably damaging	1.00
R9685:Spta1	UTSW	1	174205359	missense	probably damaging	1.00
RF002:Spta1	UTSW	1	174231360	missense	possibly damaging	0.62
RF018:Spta1	UTSW	1	174209319	missense	probably damaging	1.00
RF020:Spta1	UTSW	1	174213444	missense	probably benign	0.42
RF020:Spta1	UTSW	1	174217903	missense	probably damaging	1.00
T0722:Spta1	UTSW	1	174191066	splice site	probably benign
X0028:Spta1	UTSW	1	174224450	missense	probably damaging	1.00
Z1176:Spta1	UTSW	1	174191051	missense	probably damaging	1.00
Z1176:Spta1	UTSW	1	174240367	missense	probably damaging	0.99
Z1177:Spta1	UTSW	1	174190162	missense	probably benign	0.09
Z1177:Spta1	UTSW	1	174245689	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TCGCTGATGGTGAAGGAGTC -3'
(R):5'- GCTTGAATCTGTTGCTCCAAATTG -3'

Sequencing Primer
(F):5'- TGGACACACTGAGGCTATTGC -3'
(R):5'- GCTCCAAATTGTGTTGCATTCG -3'

Posted On

2016-03-16