Incidental Mutation 'R0280:Clcn6'
ID37444
Institutional Source Beutler Lab
Gene Symbol Clcn6
Ensembl Gene ENSMUSG00000029016
Gene Namechloride channel, voltage-sensitive 6
Synonyms
MMRRC Submission 038502-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R0280 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location148004259-148038821 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 148008715 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 836 (L836P)
Ref Sequence ENSEMBL: ENSMUSP00000121751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030879] [ENSMUST00000105711] [ENSMUST00000137724]
Predicted Effect probably damaging
Transcript: ENSMUST00000030879
AA Change: L833P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030879
Gene: ENSMUSG00000029016
AA Change: L833P

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Voltage_CLC 138 571 5.5e-98 PFAM
CBS 609 658 1.68e-3 SMART
CBS 811 859 1.34e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105711
SMART Domains Protein: ENSMUSP00000101336
Gene: ENSMUSG00000029016

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Voltage_CLC 141 574 1.5e-98 PFAM
CBS 612 661 1.68e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000137724
AA Change: L836P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121751
Gene: ENSMUSG00000029016
AA Change: L836P

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Voltage_CLC 141 574 1.9e-101 PFAM
CBS 612 661 1.68e-3 SMART
CBS 814 862 1.34e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154192
Meta Mutation Damage Score 0.9700 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: This gene encodes a member of the ClC chloride channel and transporter family of proteins. The encoded protein may function as a vesicular Cl-/H+ antiporter. Homozygous knockout mice exhibit decreased pain sensitivity, behavioral abnormalities and features of lysosomal storage disease. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired nociception, mild behavioral abnormalities, and a progressive neuropathy of the central and peripheral nervous systems with features of neuronal ceroid lipofuscinosis (a lysosomal storage disease). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Adam18 C T 8: 24,674,054 G38R probably benign Het
Ankrd16 T G 2: 11,781,501 V187G probably damaging Het
AU019823 T C 9: 50,609,379 T123A probably damaging Het
Ccdc110 A T 8: 45,943,450 N793Y probably benign Het
Ccdc170 T C 10: 4,558,663 I629T possibly damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crocc T C 4: 141,028,426 E1097G probably damaging Het
Csmd1 A T 8: 16,271,602 V494E probably damaging Het
Drg1 A T 11: 3,256,537 probably null Het
Dscam T C 16: 97,039,006 K134E possibly damaging Het
Dyrk1b T C 7: 28,184,312 Y198H probably damaging Het
Esr1 A G 10: 4,856,951 D289G probably benign Het
Esr1 G T 10: 4,939,289 V396F probably damaging Het
Evi5l T C 8: 4,193,133 V339A probably damaging Het
Fat4 A T 3: 38,890,816 Q1286L probably benign Het
Frem1 T C 4: 82,969,444 H1118R probably damaging Het
Fuk A T 8: 110,894,748 V188D probably damaging Het
Fut9 C T 4: 25,619,852 D321N probably benign Het
Gaa T G 11: 119,284,547 V917G probably damaging Het
Gm973 GCC GC 1: 59,544,680 probably null Het
Kidins220 A G 12: 25,010,141 T767A probably damaging Het
Kif7 A G 7: 79,698,823 S1257P probably benign Het
Ltn1 A G 16: 87,397,838 L1391P probably damaging Het
Mast3 A G 8: 70,783,795 Y681H probably damaging Het
Mast3 A G 8: 70,787,920 V291A possibly damaging Het
Metrn C T 17: 25,795,135 R239H probably benign Het
Mphosph10 C A 7: 64,376,703 K666N possibly damaging Het
Mtbp C T 15: 55,586,461 T433I probably benign Het
Mtmr2 A G 9: 13,799,249 K365E probably damaging Het
Nanog A G 6: 122,713,398 D229G probably damaging Het
Npepps T C 11: 97,241,014 N338S possibly damaging Het
Nphp4 T A 4: 152,551,936 probably benign Het
Olfr1279 T C 2: 111,307,072 F289S possibly damaging Het
Plcl2 A G 17: 50,607,034 E357G probably damaging Het
Polb A T 8: 22,640,392 Y173N probably damaging Het
R3hdm1 T A 1: 128,162,775 S74T probably benign Het
Raet1d T A 10: 22,370,883 C37S probably damaging Het
Reln G A 5: 22,227,513 probably benign Het
Rps6kc1 T C 1: 190,809,000 S369G probably damaging Het
Sgf29 A G 7: 126,671,571 E108G probably benign Het
Sh3tc1 A G 5: 35,706,017 L942P probably damaging Het
Slc22a27 A T 19: 7,896,822 L188* probably null Het
Slc9a3 T A 13: 74,159,424 I445N probably damaging Het
Sufu A T 19: 46,450,673 probably benign Het
Tomm40 G A 7: 19,713,751 T118I probably damaging Het
Ttc25 A T 11: 100,550,265 K107N probably damaging Het
Ttn C T 2: 76,740,479 R26690H probably damaging Het
Vmn2r16 A G 5: 109,340,139 I293V possibly damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Vsig8 A G 1: 172,561,538 D119G probably benign Het
Other mutations in Clcn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Clcn6 APN 4 148017902 critical splice donor site probably null
IGL00434:Clcn6 APN 4 148013738 missense probably damaging 1.00
IGL00973:Clcn6 APN 4 148013788 splice site probably benign
IGL01384:Clcn6 APN 4 148018966 missense probably damaging 1.00
IGL01465:Clcn6 APN 4 148021451 splice site probably benign
IGL01522:Clcn6 APN 4 148017535 missense probably benign 0.44
R0194:Clcn6 UTSW 4 148012756 missense probably damaging 1.00
R0349:Clcn6 UTSW 4 148024194 missense possibly damaging 0.89
R0352:Clcn6 UTSW 4 148014606 missense probably damaging 1.00
R0586:Clcn6 UTSW 4 148038749 unclassified probably benign
R0927:Clcn6 UTSW 4 148029392 missense probably benign 0.30
R1141:Clcn6 UTSW 4 148013899 missense probably damaging 0.99
R1465:Clcn6 UTSW 4 148013901 missense probably damaging 1.00
R1465:Clcn6 UTSW 4 148013901 missense probably damaging 1.00
R1473:Clcn6 UTSW 4 148024156 missense possibly damaging 0.93
R1551:Clcn6 UTSW 4 148012778 missense possibly damaging 0.74
R1571:Clcn6 UTSW 4 148012769 missense possibly damaging 0.63
R1593:Clcn6 UTSW 4 148014594 missense probably benign
R1596:Clcn6 UTSW 4 148023379 missense probably damaging 1.00
R1706:Clcn6 UTSW 4 148017568 missense probably benign 0.00
R1769:Clcn6 UTSW 4 148014301 intron probably null
R2021:Clcn6 UTSW 4 148010652 critical splice donor site probably null
R2022:Clcn6 UTSW 4 148010652 critical splice donor site probably null
R2049:Clcn6 UTSW 4 148024137 missense possibly damaging 0.88
R2081:Clcn6 UTSW 4 148011068 missense probably damaging 1.00
R2140:Clcn6 UTSW 4 148024137 missense possibly damaging 0.88
R2141:Clcn6 UTSW 4 148024137 missense possibly damaging 0.88
R2142:Clcn6 UTSW 4 148024137 missense possibly damaging 0.88
R2177:Clcn6 UTSW 4 148014600 missense possibly damaging 0.73
R2511:Clcn6 UTSW 4 148017494 critical splice donor site probably null
R2891:Clcn6 UTSW 4 148012616 critical splice donor site probably null
R3750:Clcn6 UTSW 4 148024187 nonsense probably null
R4014:Clcn6 UTSW 4 148017610 missense probably damaging 0.98
R4023:Clcn6 UTSW 4 148014283 missense possibly damaging 0.91
R4024:Clcn6 UTSW 4 148014283 missense possibly damaging 0.91
R4025:Clcn6 UTSW 4 148014283 missense possibly damaging 0.91
R4667:Clcn6 UTSW 4 148024167 missense possibly damaging 0.61
R4865:Clcn6 UTSW 4 148019766 missense probably damaging 1.00
R4978:Clcn6 UTSW 4 148008770 missense probably benign 0.05
R5140:Clcn6 UTSW 4 148038317 unclassified probably benign
R5345:Clcn6 UTSW 4 148038749 unclassified probably benign
R5467:Clcn6 UTSW 4 148017636 missense possibly damaging 0.81
R5665:Clcn6 UTSW 4 148014561 missense possibly damaging 0.71
R5739:Clcn6 UTSW 4 148014189 missense probably damaging 1.00
R5899:Clcn6 UTSW 4 148017592 missense probably benign 0.01
R6043:Clcn6 UTSW 4 148008788 missense probably damaging 1.00
R6351:Clcn6 UTSW 4 148017500 missense probably benign 0.01
R6593:Clcn6 UTSW 4 148010769 missense probably benign 0.21
R7440:Clcn6 UTSW 4 148014195 missense probably damaging 1.00
R7674:Clcn6 UTSW 4 148012694 missense probably damaging 1.00
R7756:Clcn6 UTSW 4 148029439 missense probably damaging 1.00
V7732:Clcn6 UTSW 4 148013955 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGGGTGCTTTCTTTAAACCCCTCTG -3'
(R):5'- TCACACTGCTGAATCCCCGAATG -3'

Sequencing Primer
(F):5'- TGCTATGAACACCCGTAAGAG -3'
(R):5'- CTGAATCCCCGAATGATTGTG -3'
Posted On2013-05-23