Mutagenetix > Incidental Mutations

Incidental Mutation 'R0280:Clcn6'

37444

Institutional Source

Beutler Lab

Gene Symbol

Clcn6

Ensembl Gene

ENSMUSG00000029016

Gene Name

chloride channel, voltage-sensitive 6

Synonyms

MMRRC Submission

038502-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.178) question?

Stock #

R0280 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

148004259-148038821 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 148008715 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 836 (L836P)

Ref Sequence

ENSEMBL: ENSMUSP00000121751 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030879] [ENSMUST00000105711] [ENSMUST00000137724]

Predicted Effect

probably damaging
Transcript: ENSMUST00000030879
AA Change: L833P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030879
Gene: ENSMUSG00000029016
AA Change: L833P

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
Pfam:Voltage_CLC	138	571	5.5e-98	PFAM
CBS	609	658	1.68e-3	SMART
CBS	811	859	1.34e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105711

SMART Domains

Protein: ENSMUSP00000101336
Gene: ENSMUSG00000029016

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
Pfam:Voltage_CLC	141	574	1.5e-98	PFAM
CBS	612	661	1.68e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000137724
AA Change: L836P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000121751
Gene: ENSMUSG00000029016
AA Change: L836P

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
Pfam:Voltage_CLC	141	574	1.9e-101	PFAM
CBS	612	661	1.68e-3	SMART
CBS	814	862	1.34e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154192

Meta Mutation Damage Score

0.9700

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.9%
20x: 94.6%

Validation Efficiency

96% (55/57)

MGI Phenotype

FUNCTION: This gene encodes a member of the ClC chloride channel and transporter family of proteins. The encoded protein may function as a vesicular Cl-/H+ antiporter. Homozygous knockout mice exhibit decreased pain sensitivity, behavioral abnormalities and features of lysosomal storage disease. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired nociception, mild behavioral abnormalities, and a progressive neuropathy of the central and peripheral nervous systems with features of neuronal ceroid lipofuscinosis (a lysosomal storage disease). [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
Adam18	C	T	8: 24,674,054	G38R	probably benign	Het
Ankrd16	T	G	2: 11,781,501	V187G	probably damaging	Het
AU019823	T	C	9: 50,609,379	T123A	probably damaging	Het
Ccdc110	A	T	8: 45,943,450	N793Y	probably benign	Het
Ccdc170	T	C	10: 4,558,663	I629T	possibly damaging	Het
Colgalt2	G	T	1: 152,508,561	A551S	possibly damaging	Het
Crocc	T	C	4: 141,028,426	E1097G	probably damaging	Het
Csmd1	A	T	8: 16,271,602	V494E	probably damaging	Het
Drg1	A	T	11: 3,256,537		probably null	Het
Dscam	T	C	16: 97,039,006	K134E	possibly damaging	Het
Dyrk1b	T	C	7: 28,184,312	Y198H	probably damaging	Het
Esr1	A	G	10: 4,856,951	D289G	probably benign	Het
Esr1	G	T	10: 4,939,289	V396F	probably damaging	Het
Evi5l	T	C	8: 4,193,133	V339A	probably damaging	Het
Fat4	A	T	3: 38,890,816	Q1286L	probably benign	Het
Frem1	T	C	4: 82,969,444	H1118R	probably damaging	Het
Fuk	A	T	8: 110,894,748	V188D	probably damaging	Het
Fut9	C	T	4: 25,619,852	D321N	probably benign	Het
Gaa	T	G	11: 119,284,547	V917G	probably damaging	Het
Gm973	GCC	GC	1: 59,544,680		probably null	Het
Kidins220	A	G	12: 25,010,141	T767A	probably damaging	Het
Kif7	A	G	7: 79,698,823	S1257P	probably benign	Het
Ltn1	A	G	16: 87,397,838	L1391P	probably damaging	Het
Mast3	A	G	8: 70,783,795	Y681H	probably damaging	Het
Mast3	A	G	8: 70,787,920	V291A	possibly damaging	Het
Metrn	C	T	17: 25,795,135	R239H	probably benign	Het
Mphosph10	C	A	7: 64,376,703	K666N	possibly damaging	Het
Mtbp	C	T	15: 55,586,461	T433I	probably benign	Het
Mtmr2	A	G	9: 13,799,249	K365E	probably damaging	Het
Nanog	A	G	6: 122,713,398	D229G	probably damaging	Het
Npepps	T	C	11: 97,241,014	N338S	possibly damaging	Het
Nphp4	T	A	4: 152,551,936		probably benign	Het
Olfr1279	T	C	2: 111,307,072	F289S	possibly damaging	Het
Plcl2	A	G	17: 50,607,034	E357G	probably damaging	Het
Polb	A	T	8: 22,640,392	Y173N	probably damaging	Het
R3hdm1	T	A	1: 128,162,775	S74T	probably benign	Het
Raet1d	T	A	10: 22,370,883	C37S	probably damaging	Het
Reln	G	A	5: 22,227,513		probably benign	Het
Rps6kc1	T	C	1: 190,809,000	S369G	probably damaging	Het
Sgf29	A	G	7: 126,671,571	E108G	probably benign	Het
Sh3tc1	A	G	5: 35,706,017	L942P	probably damaging	Het
Slc22a27	A	T	19: 7,896,822	L188*	probably null	Het
Slc9a3	T	A	13: 74,159,424	I445N	probably damaging	Het
Sufu	A	T	19: 46,450,673		probably benign	Het
Tomm40	G	A	7: 19,713,751	T118I	probably damaging	Het
Ttc25	A	T	11: 100,550,265	K107N	probably damaging	Het
Ttn	C	T	2: 76,740,479	R26690H	probably damaging	Het
Vmn2r16	A	G	5: 109,340,139	I293V	possibly damaging	Het
Vmn2r68	T	A	7: 85,233,249		probably benign	Het
Vmn2r68	C	G	7: 85,233,258		probably null	Het
Vsig8	A	G	1: 172,561,538	D119G	probably benign	Het

Other mutations in Clcn6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Clcn6	APN	4	148017902	critical splice donor site	probably null
IGL00434:Clcn6	APN	4	148013738	missense	probably damaging	1.00
IGL00973:Clcn6	APN	4	148013788	splice site	probably benign
IGL01384:Clcn6	APN	4	148018966	missense	probably damaging	1.00
IGL01465:Clcn6	APN	4	148021451	splice site	probably benign
IGL01522:Clcn6	APN	4	148017535	missense	probably benign	0.44
R0194:Clcn6	UTSW	4	148012756	missense	probably damaging	1.00
R0349:Clcn6	UTSW	4	148024194	missense	possibly damaging	0.89
R0352:Clcn6	UTSW	4	148014606	missense	probably damaging	1.00
R0586:Clcn6	UTSW	4	148038749	unclassified	probably benign
R0927:Clcn6	UTSW	4	148029392	missense	probably benign	0.30
R1141:Clcn6	UTSW	4	148013899	missense	probably damaging	0.99
R1465:Clcn6	UTSW	4	148013901	missense	probably damaging	1.00
R1465:Clcn6	UTSW	4	148013901	missense	probably damaging	1.00
R1473:Clcn6	UTSW	4	148024156	missense	possibly damaging	0.93
R1551:Clcn6	UTSW	4	148012778	missense	possibly damaging	0.74
R1571:Clcn6	UTSW	4	148012769	missense	possibly damaging	0.63
R1593:Clcn6	UTSW	4	148014594	missense	probably benign
R1596:Clcn6	UTSW	4	148023379	missense	probably damaging	1.00
R1706:Clcn6	UTSW	4	148017568	missense	probably benign	0.00
R1769:Clcn6	UTSW	4	148014301	intron	probably null
R2021:Clcn6	UTSW	4	148010652	critical splice donor site	probably null
R2022:Clcn6	UTSW	4	148010652	critical splice donor site	probably null
R2049:Clcn6	UTSW	4	148024137	missense	possibly damaging	0.88
R2081:Clcn6	UTSW	4	148011068	missense	probably damaging	1.00
R2140:Clcn6	UTSW	4	148024137	missense	possibly damaging	0.88
R2141:Clcn6	UTSW	4	148024137	missense	possibly damaging	0.88
R2142:Clcn6	UTSW	4	148024137	missense	possibly damaging	0.88
R2177:Clcn6	UTSW	4	148014600	missense	possibly damaging	0.73
R2511:Clcn6	UTSW	4	148017494	critical splice donor site	probably null
R2891:Clcn6	UTSW	4	148012616	critical splice donor site	probably null
R3750:Clcn6	UTSW	4	148024187	nonsense	probably null
R4014:Clcn6	UTSW	4	148017610	missense	probably damaging	0.98
R4023:Clcn6	UTSW	4	148014283	missense	possibly damaging	0.91
R4024:Clcn6	UTSW	4	148014283	missense	possibly damaging	0.91
R4025:Clcn6	UTSW	4	148014283	missense	possibly damaging	0.91
R4667:Clcn6	UTSW	4	148024167	missense	possibly damaging	0.61
R4865:Clcn6	UTSW	4	148019766	missense	probably damaging	1.00
R4978:Clcn6	UTSW	4	148008770	missense	probably benign	0.05
R5140:Clcn6	UTSW	4	148038317	unclassified	probably benign
R5345:Clcn6	UTSW	4	148038749	unclassified	probably benign
R5467:Clcn6	UTSW	4	148017636	missense	possibly damaging	0.81
R5665:Clcn6	UTSW	4	148014561	missense	possibly damaging	0.71
R5739:Clcn6	UTSW	4	148014189	missense	probably damaging	1.00
R5899:Clcn6	UTSW	4	148017592	missense	probably benign	0.01
R6043:Clcn6	UTSW	4	148008788	missense	probably damaging	1.00
R6351:Clcn6	UTSW	4	148017500	missense	probably benign	0.01
R6593:Clcn6	UTSW	4	148010769	missense	probably benign	0.21
R7440:Clcn6	UTSW	4	148014195	missense	probably damaging	1.00
R7674:Clcn6	UTSW	4	148012694	missense	probably damaging	1.00
R7756:Clcn6	UTSW	4	148029439	missense	probably damaging	1.00
V7732:Clcn6	UTSW	4	148013955	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GGGGTGCTTTCTTTAAACCCCTCTG -3'
(R):5'- TCACACTGCTGAATCCCCGAATG -3'

Sequencing Primer
(F):5'- TGCTATGAACACCCGTAAGAG -3'
(R):5'- CTGAATCCCCGAATGATTGTG -3'

Posted On

2013-05-23