Incidental Mutation 'R4838:Pou2f1'
ID374440
Institutional Source Beutler Lab
Gene Symbol Pou2f1
Ensembl Gene ENSMUSG00000026565
Gene NamePOU domain, class 2, transcription factor 1
Synonymsoct-1, Otf1, Oct-1C, Otf-1, Oct-1B, Oct1, Oct-1z, 2810482H01Rik, Oct-1A
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4838 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location165865154-166002678 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 165916923 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 53 (Q53L)
Ref Sequence ENSEMBL: ENSMUSP00000135565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027850] [ENSMUST00000069609] [ENSMUST00000111426] [ENSMUST00000111427] [ENSMUST00000111429] [ENSMUST00000159212] [ENSMUST00000160260] [ENSMUST00000160908] [ENSMUST00000177358] [ENSMUST00000184643]
Predicted Effect probably null
Transcript: ENSMUST00000027850
AA Change: Q76L
SMART Domains Protein: ENSMUSP00000027850
Gene: ENSMUSG00000026565
AA Change: Q76L

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 94 123 N/A INTRINSIC
low complexity region 137 152 N/A INTRINSIC
low complexity region 171 192 N/A INTRINSIC
low complexity region 199 217 N/A INTRINSIC
POU 241 315 1.55e-52 SMART
low complexity region 316 332 N/A INTRINSIC
HOX 342 404 2.54e-19 SMART
low complexity region 422 448 N/A INTRINSIC
low complexity region 453 520 N/A INTRINSIC
low complexity region 529 567 N/A INTRINSIC
low complexity region 675 685 N/A INTRINSIC
low complexity region 688 705 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000069609
AA Change: Q65L
SMART Domains Protein: ENSMUSP00000064000
Gene: ENSMUSG00000026565
AA Change: Q65L

DomainStartEndE-ValueType
low complexity region 83 112 N/A INTRINSIC
low complexity region 130 172 N/A INTRINSIC
low complexity region 189 204 N/A INTRINSIC
low complexity region 223 244 N/A INTRINSIC
low complexity region 251 269 N/A INTRINSIC
POU 293 367 1.55e-52 SMART
low complexity region 368 384 N/A INTRINSIC
HOX 394 456 2.54e-19 SMART
low complexity region 474 500 N/A INTRINSIC
low complexity region 505 572 N/A INTRINSIC
low complexity region 581 619 N/A INTRINSIC
low complexity region 727 737 N/A INTRINSIC
low complexity region 740 757 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082225
SMART Domains Protein: ENSMUSP00000080856
Gene: ENSMUSG00000026565

DomainStartEndE-ValueType
low complexity region 83 112 N/A INTRINSIC
low complexity region 130 172 N/A INTRINSIC
low complexity region 189 204 N/A INTRINSIC
POU 233 309 4.88e-27 SMART
low complexity region 310 326 N/A INTRINSIC
HOX 336 398 2.54e-19 SMART
low complexity region 416 442 N/A INTRINSIC
low complexity region 447 514 N/A INTRINSIC
low complexity region 523 561 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111426
AA Change: Q65L

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107055
Gene: ENSMUSG00000026565
AA Change: Q65L

DomainStartEndE-ValueType
low complexity region 83 112 N/A INTRINSIC
low complexity region 130 172 N/A INTRINSIC
low complexity region 189 204 N/A INTRINSIC
low complexity region 223 244 N/A INTRINSIC
low complexity region 251 269 N/A INTRINSIC
POU 293 367 6.7e-55 SMART
low complexity region 368 384 N/A INTRINSIC
HOX 394 456 1.3e-21 SMART
low complexity region 474 500 N/A INTRINSIC
low complexity region 531 596 N/A INTRINSIC
low complexity region 605 643 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111427
AA Change: Q65L
SMART Domains Protein: ENSMUSP00000107056
Gene: ENSMUSG00000026565
AA Change: Q65L

DomainStartEndE-ValueType
low complexity region 83 112 N/A INTRINSIC
low complexity region 130 172 N/A INTRINSIC
low complexity region 189 204 N/A INTRINSIC
low complexity region 223 244 N/A INTRINSIC
low complexity region 251 269 N/A INTRINSIC
POU 293 367 1.55e-52 SMART
low complexity region 368 384 N/A INTRINSIC
HOX 394 456 2.54e-19 SMART
low complexity region 474 500 N/A INTRINSIC
low complexity region 531 596 N/A INTRINSIC
low complexity region 605 643 N/A INTRINSIC
low complexity region 751 761 N/A INTRINSIC
low complexity region 764 781 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111429
AA Change: Q53L
SMART Domains Protein: ENSMUSP00000107057
Gene: ENSMUSG00000026565
AA Change: Q53L

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
low complexity region 118 160 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
low complexity region 211 232 N/A INTRINSIC
low complexity region 239 257 N/A INTRINSIC
POU 281 355 6.7e-55 SMART
low complexity region 356 372 N/A INTRINSIC
HOX 382 444 1.3e-21 SMART
low complexity region 462 488 N/A INTRINSIC
low complexity region 493 560 N/A INTRINSIC
low complexity region 569 607 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159212
SMART Domains Protein: ENSMUSP00000125371
Gene: ENSMUSG00000026565

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
low complexity region 118 160 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
low complexity region 211 232 N/A INTRINSIC
low complexity region 239 257 N/A INTRINSIC
POU 281 355 1.55e-52 SMART
low complexity region 356 372 N/A INTRINSIC
HOX 382 444 2.54e-19 SMART
low complexity region 462 488 N/A INTRINSIC
low complexity region 493 560 N/A INTRINSIC
low complexity region 569 607 N/A INTRINSIC
low complexity region 715 725 N/A INTRINSIC
low complexity region 728 745 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160260
AA Change: Q76L
SMART Domains Protein: ENSMUSP00000124738
Gene: ENSMUSG00000026565
AA Change: Q76L

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 94 123 N/A INTRINSIC
low complexity region 141 183 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
low complexity region 262 280 N/A INTRINSIC
POU 304 378 1.55e-52 SMART
low complexity region 379 395 N/A INTRINSIC
HOX 405 467 2.54e-19 SMART
low complexity region 485 511 N/A INTRINSIC
low complexity region 542 607 N/A INTRINSIC
low complexity region 616 654 N/A INTRINSIC
low complexity region 762 772 N/A INTRINSIC
low complexity region 775 792 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160908
AA Change: Q76L
SMART Domains Protein: ENSMUSP00000125444
Gene: ENSMUSG00000026565
AA Change: Q76L

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 94 123 N/A INTRINSIC
low complexity region 141 183 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
low complexity region 262 280 N/A INTRINSIC
POU 304 378 1.55e-52 SMART
low complexity region 379 395 N/A INTRINSIC
HOX 405 467 2.54e-19 SMART
low complexity region 485 511 N/A INTRINSIC
low complexity region 516 583 N/A INTRINSIC
low complexity region 592 630 N/A INTRINSIC
low complexity region 738 748 N/A INTRINSIC
low complexity region 751 768 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176942
SMART Domains Protein: ENSMUSP00000135052
Gene: ENSMUSG00000026565

DomainStartEndE-ValueType
low complexity region 65 94 N/A INTRINSIC
low complexity region 112 154 N/A INTRINSIC
low complexity region 171 186 N/A INTRINSIC
low complexity region 205 226 N/A INTRINSIC
low complexity region 233 251 N/A INTRINSIC
POU 275 349 1.55e-52 SMART
low complexity region 350 366 N/A INTRINSIC
HOX 376 438 2.54e-19 SMART
low complexity region 456 482 N/A INTRINSIC
low complexity region 487 554 N/A INTRINSIC
low complexity region 563 601 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000177358
AA Change: Q53L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135565
Gene: ENSMUSG00000026565
AA Change: Q53L

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
low complexity region 118 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177472
Predicted Effect probably null
Transcript: ENSMUST00000184643
AA Change: Q53L
SMART Domains Protein: ENSMUSP00000138962
Gene: ENSMUSG00000026565
AA Change: Q53L

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
low complexity region 118 160 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
low complexity region 211 232 N/A INTRINSIC
low complexity region 239 257 N/A INTRINSIC
POU 281 355 6.7e-55 SMART
low complexity region 356 372 N/A INTRINSIC
HOX 382 444 1.3e-21 SMART
low complexity region 462 488 N/A INTRINSIC
low complexity region 493 560 N/A INTRINSIC
low complexity region 569 607 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The OCT1 transcription factor was among the first identified members of the POU transcription factor family (summarized by Sturm et al., 1993 [PubMed 8314572]). Members of this family contain the POU domain, a 160-amino acid region necessary for DNA binding to the octameric sequence ATGCAAAT.[supplied by OMIM, Jul 2010]
PHENOTYPE: Homozygous mutation of this gene results in prenatal lethality, with earlier lethality on either a 129/Sv or C57BL/6 background than a mixed 129/Sv and C57BL/6 background. Embryos show decreased erythropoiesis and partial penetrance of small lens size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A T 9: 22,424,377 D97V probably damaging Het
Abca15 T C 7: 120,345,300 V386A probably benign Het
Adk G A 14: 21,369,086 A247T probably damaging Het
Ankrd27 T A 7: 35,591,806 L9Q possibly damaging Het
Atad2 A G 15: 58,103,283 L638P probably damaging Het
Atf7ip T A 6: 136,596,491 D1009E probably benign Het
Bend7 A T 2: 4,744,322 K83N probably damaging Het
Bicc1 C T 10: 70,945,316 D562N possibly damaging Het
Calcrl T A 2: 84,351,205 N200Y probably damaging Het
Ccdc125 C A 13: 100,677,945 A11E possibly damaging Het
Cd5l A G 3: 87,365,951 T76A probably benign Het
Cdhr5 A T 7: 141,273,731 I2N probably damaging Het
Cdk10 C T 8: 123,230,614 A230V probably damaging Het
Cep128 T C 12: 90,999,545 probably benign Het
Cep131 T C 11: 120,076,156 N186D probably damaging Het
Cog7 G T 7: 121,971,381 P168Q probably damaging Het
Col28a1 T A 6: 8,014,559 M949L probably benign Het
Coq8b T A 7: 27,250,591 M365K probably damaging Het
Cpa1 A G 6: 30,639,516 E18G possibly damaging Het
Csmd2 A G 4: 128,517,749 H2520R probably benign Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dpm1 G A 2: 168,210,536 T260I probably damaging Het
Dtx3 A T 10: 127,191,307 probably null Het
Eepd1 T C 9: 25,589,460 V401A possibly damaging Het
Ehhadh A G 16: 21,763,202 S347P possibly damaging Het
Elp3 A G 14: 65,547,864 probably null Het
Enam C T 5: 88,493,108 Q210* probably null Het
Epha1 C T 6: 42,363,816 R607H probably benign Het
Erich6 A G 3: 58,636,830 I112T probably benign Het
F830045P16Rik A G 2: 129,460,550 V374A possibly damaging Het
Fam171a2 C A 11: 102,438,685 R416L possibly damaging Het
Fam35a A G 14: 34,268,625 V108A probably benign Het
Fbn1 T C 2: 125,372,399 N764S probably benign Het
Fip1l1 C T 5: 74,591,939 T469I probably damaging Het
Flad1 G A 3: 89,405,910 R342C probably damaging Het
Fzd3 A G 14: 65,239,820 V95A probably benign Het
Garem1 T C 18: 21,147,893 T469A probably benign Het
Gm13084 G A 4: 143,810,805 Q319* probably null Het
Gm17093 A G 14: 44,518,348 Y24C unknown Het
Gm4788 T A 1: 139,733,443 D556V probably damaging Het
Gm7534 A G 4: 134,193,099 V585A probably benign Het
Grap2 T C 15: 80,638,561 V96A possibly damaging Het
Greb1 A T 12: 16,684,360 probably null Het
Grid2ip A T 5: 143,388,775 K913* probably null Het
Gzmk T C 13: 113,173,021 D126G probably damaging Het
Hibch A G 1: 52,885,178 I171V possibly damaging Het
Hipk2 G T 6: 38,818,404 T310K possibly damaging Het
Hk3 T C 13: 55,006,418 Y815C probably damaging Het
Hps5 A T 7: 46,788,354 V99E probably damaging Het
Hspg2 A G 4: 137,541,666 H2203R possibly damaging Het
Il12rb2 A G 6: 67,309,137 V108A probably damaging Het
Il6st C T 13: 112,490,510 R279* probably null Het
Kdm2a A C 19: 4,325,026 S692R probably benign Het
Kif13a T C 13: 46,826,748 K176R probably damaging Het
Kif5b T C 18: 6,216,869 K485E probably damaging Het
Ktn1 C T 14: 47,725,956 R1111* probably null Het
Lrrc23 A T 6: 124,778,189 N128K probably benign Het
Mad1l1 G A 5: 140,300,262 Q293* probably null Het
Man1b1 A T 2: 25,345,475 I338F possibly damaging Het
March1 G T 8: 66,468,363 V225L probably damaging Het
Mrpl3 A G 9: 105,057,032 D118G probably damaging Het
Nomo1 A T 7: 46,083,715 Q1209L unknown Het
Nrcam A G 12: 44,574,019 E949G probably damaging Het
Olfm5 T G 7: 104,154,365 N297T probably damaging Het
Olfr573-ps1 T A 7: 102,942,246 L110F probably damaging Het
Pcdh7 A T 5: 57,720,804 N567I probably damaging Het
Pkn1 A G 8: 83,677,966 L495P probably damaging Het
Pkp1 T C 1: 135,882,588 S415G probably damaging Het
Prkce A G 17: 86,630,083 K648R probably benign Het
Ptprh G A 7: 4,573,430 T277I possibly damaging Het
Rpl31 C T 1: 39,370,967 R83C probably benign Het
Rpusd3 G A 6: 113,416,876 Q194* probably null Het
Sgsm1 T A 5: 113,282,626 N298Y probably damaging Het
She G A 3: 89,851,639 G355D probably benign Het
Snx11 C T 11: 96,774,458 E9K possibly damaging Het
Soat1 C A 1: 156,432,937 A444S probably benign Het
Sox6 T C 7: 115,486,662 Y690C probably damaging Het
Spata13 T A 14: 60,733,179 F10I probably benign Het
St18 C A 1: 6,802,905 T288K probably benign Het
Tifa C T 3: 127,796,586 S2F probably damaging Het
Tmem232 A T 17: 65,430,888 S392R probably benign Het
Tmtc3 T C 10: 100,466,220 N289S probably damaging Het
Tpo A G 12: 30,092,634 F697S probably damaging Het
Trp53 A G 11: 69,587,630 T122A probably damaging Het
Trps1 A C 15: 50,827,316 I10S probably benign Het
Tubgcp5 C T 7: 55,794,185 probably benign Het
Unc13c T G 9: 73,932,072 Y499S possibly damaging Het
Unc45a C A 7: 80,333,035 D381Y probably damaging Het
Upf1 G C 8: 70,339,368 H402Q probably benign Het
Uroc1 A T 6: 90,349,192 I510F possibly damaging Het
Usp15 A G 10: 123,127,757 F589L probably damaging Het
Vmn2r76 T C 7: 86,225,525 Y748C probably damaging Het
Wwp1 T C 4: 19,662,143 N151D probably benign Het
Zbtb40 A T 4: 137,001,216 S439T probably benign Het
Zbtb6 A T 2: 37,428,716 L400* probably null Het
Zfp125 C T 12: 20,899,960 noncoding transcript Het
Zmynd8 A C 2: 165,840,034 Y183* probably null Het
Other mutations in Pou2f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Pou2f1 APN 1 165902298 missense probably damaging 1.00
IGL00392:Pou2f1 APN 1 165896590 splice site probably benign
IGL01627:Pou2f1 APN 1 165880433 unclassified probably benign
IGL01707:Pou2f1 APN 1 165915116 missense probably damaging 0.96
IGL02735:Pou2f1 APN 1 165875827 missense probably damaging 1.00
IGL02740:Pou2f1 APN 1 165883116 nonsense probably null
IGL03117:Pou2f1 APN 1 165934813 missense probably benign 0.00
IGL03272:Pou2f1 APN 1 165896480 missense possibly damaging 0.67
R0021:Pou2f1 UTSW 1 165876018 missense probably damaging 1.00
R1437:Pou2f1 UTSW 1 165891830 missense probably damaging 0.98
R2171:Pou2f1 UTSW 1 165880356 unclassified probably benign
R3722:Pou2f1 UTSW 1 165894969 missense probably damaging 1.00
R3789:Pou2f1 UTSW 1 165894969 missense probably damaging 1.00
R3790:Pou2f1 UTSW 1 165894969 missense probably damaging 1.00
R3901:Pou2f1 UTSW 1 165894969 missense probably damaging 1.00
R4225:Pou2f1 UTSW 1 165911320 missense possibly damaging 0.79
R4459:Pou2f1 UTSW 1 165895006 missense probably damaging 1.00
R4460:Pou2f1 UTSW 1 165895006 missense probably damaging 1.00
R4573:Pou2f1 UTSW 1 165913261 missense probably benign 0.29
R4820:Pou2f1 UTSW 1 165891948 intron probably benign
R5579:Pou2f1 UTSW 1 165915162 missense probably damaging 1.00
R5856:Pou2f1 UTSW 1 165915130 missense probably benign 0.14
R5951:Pou2f1 UTSW 1 165883056 unclassified probably benign
R6128:Pou2f1 UTSW 1 165875487 unclassified probably benign
R6145:Pou2f1 UTSW 1 165875433 unclassified probably benign
R6216:Pou2f1 UTSW 1 165880320 unclassified probably benign
R6971:Pou2f1 UTSW 1 165931689 missense probably damaging 0.98
R7052:Pou2f1 UTSW 1 165915115 missense possibly damaging 0.59
R7403:Pou2f1 UTSW 1 165911386 missense unknown
R7404:Pou2f1 UTSW 1 165911386 missense unknown
X0022:Pou2f1 UTSW 1 165896456 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCACAGACTCAAGCTCATGC -3'
(R):5'- CAAGTTCCTACTGATGTTGGTAACTG -3'

Sequencing Primer
(F):5'- CTCATAGGAAAAAGTGACCTCGCTG -3'
(R):5'- CCTACTGATGTTGGTAACTGTAGTTG -3'
Posted On2016-03-16