Incidental Mutation 'R4838:Greb1'
ID374441
Institutional Source Beutler Lab
Gene Symbol Greb1
Ensembl Gene ENSMUSG00000036523
Gene Namegene regulated by estrogen in breast cancer protein
Synonyms5730583K22Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4838 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location16670615-16800886 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 16684360 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000048064] [ENSMUST00000048064] [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000159120] [ENSMUST00000159120] [ENSMUST00000159120] [ENSMUST00000162112] [ENSMUST00000162112]
Predicted Effect probably null
Transcript: ENSMUST00000048064
SMART Domains Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523

DomainStartEndE-ValueType
Pfam:GREB1 1 1954 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000048064
SMART Domains Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523

DomainStartEndE-ValueType
Pfam:GREB1 1 1954 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000048064
SMART Domains Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523

DomainStartEndE-ValueType
Pfam:GREB1 1 1954 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000048064
SMART Domains Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523

DomainStartEndE-ValueType
Pfam:GREB1 1 1954 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159120
SMART Domains Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1596 1607 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159120
SMART Domains Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1596 1607 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159120
SMART Domains Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1596 1607 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159120
SMART Domains Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1596 1607 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160755
Predicted Effect probably null
Transcript: ENSMUST00000162112
SMART Domains Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1128 1146 N/A INTRINSIC
low complexity region 1224 1235 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1624 1635 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162112
SMART Domains Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1128 1146 N/A INTRINSIC
low complexity region 1224 1235 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1624 1635 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223113
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A T 9: 22,424,377 D97V probably damaging Het
Abca15 T C 7: 120,345,300 V386A probably benign Het
Adk G A 14: 21,369,086 A247T probably damaging Het
Ankrd27 T A 7: 35,591,806 L9Q possibly damaging Het
Atad2 A G 15: 58,103,283 L638P probably damaging Het
Atf7ip T A 6: 136,596,491 D1009E probably benign Het
Bend7 A T 2: 4,744,322 K83N probably damaging Het
Bicc1 C T 10: 70,945,316 D562N possibly damaging Het
Calcrl T A 2: 84,351,205 N200Y probably damaging Het
Ccdc125 C A 13: 100,677,945 A11E possibly damaging Het
Cd5l A G 3: 87,365,951 T76A probably benign Het
Cdhr5 A T 7: 141,273,731 I2N probably damaging Het
Cdk10 C T 8: 123,230,614 A230V probably damaging Het
Cep128 T C 12: 90,999,545 probably benign Het
Cep131 T C 11: 120,076,156 N186D probably damaging Het
Cog7 G T 7: 121,971,381 P168Q probably damaging Het
Col28a1 T A 6: 8,014,559 M949L probably benign Het
Coq8b T A 7: 27,250,591 M365K probably damaging Het
Cpa1 A G 6: 30,639,516 E18G possibly damaging Het
Csmd2 A G 4: 128,517,749 H2520R probably benign Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dpm1 G A 2: 168,210,536 T260I probably damaging Het
Dtx3 A T 10: 127,191,307 probably null Het
Eepd1 T C 9: 25,589,460 V401A possibly damaging Het
Ehhadh A G 16: 21,763,202 S347P possibly damaging Het
Elp3 A G 14: 65,547,864 probably null Het
Enam C T 5: 88,493,108 Q210* probably null Het
Epha1 C T 6: 42,363,816 R607H probably benign Het
Erich6 A G 3: 58,636,830 I112T probably benign Het
F830045P16Rik A G 2: 129,460,550 V374A possibly damaging Het
Fam171a2 C A 11: 102,438,685 R416L possibly damaging Het
Fam35a A G 14: 34,268,625 V108A probably benign Het
Fbn1 T C 2: 125,372,399 N764S probably benign Het
Fip1l1 C T 5: 74,591,939 T469I probably damaging Het
Flad1 G A 3: 89,405,910 R342C probably damaging Het
Fzd3 A G 14: 65,239,820 V95A probably benign Het
Garem1 T C 18: 21,147,893 T469A probably benign Het
Gm13084 G A 4: 143,810,805 Q319* probably null Het
Gm17093 A G 14: 44,518,348 Y24C unknown Het
Gm4788 T A 1: 139,733,443 D556V probably damaging Het
Gm7534 A G 4: 134,193,099 V585A probably benign Het
Grap2 T C 15: 80,638,561 V96A possibly damaging Het
Grid2ip A T 5: 143,388,775 K913* probably null Het
Gzmk T C 13: 113,173,021 D126G probably damaging Het
Hibch A G 1: 52,885,178 I171V possibly damaging Het
Hipk2 G T 6: 38,818,404 T310K possibly damaging Het
Hk3 T C 13: 55,006,418 Y815C probably damaging Het
Hps5 A T 7: 46,788,354 V99E probably damaging Het
Hspg2 A G 4: 137,541,666 H2203R possibly damaging Het
Il12rb2 A G 6: 67,309,137 V108A probably damaging Het
Il6st C T 13: 112,490,510 R279* probably null Het
Kdm2a A C 19: 4,325,026 S692R probably benign Het
Kif13a T C 13: 46,826,748 K176R probably damaging Het
Kif5b T C 18: 6,216,869 K485E probably damaging Het
Ktn1 C T 14: 47,725,956 R1111* probably null Het
Lrrc23 A T 6: 124,778,189 N128K probably benign Het
Mad1l1 G A 5: 140,300,262 Q293* probably null Het
Man1b1 A T 2: 25,345,475 I338F possibly damaging Het
March1 G T 8: 66,468,363 V225L probably damaging Het
Mrpl3 A G 9: 105,057,032 D118G probably damaging Het
Nomo1 A T 7: 46,083,715 Q1209L unknown Het
Nrcam A G 12: 44,574,019 E949G probably damaging Het
Olfm5 T G 7: 104,154,365 N297T probably damaging Het
Olfr573-ps1 T A 7: 102,942,246 L110F probably damaging Het
Pcdh7 A T 5: 57,720,804 N567I probably damaging Het
Pkn1 A G 8: 83,677,966 L495P probably damaging Het
Pkp1 T C 1: 135,882,588 S415G probably damaging Het
Pou2f1 T A 1: 165,916,923 Q53L probably null Het
Prkce A G 17: 86,630,083 K648R probably benign Het
Ptprh G A 7: 4,573,430 T277I possibly damaging Het
Rpl31 C T 1: 39,370,967 R83C probably benign Het
Rpusd3 G A 6: 113,416,876 Q194* probably null Het
Sgsm1 T A 5: 113,282,626 N298Y probably damaging Het
She G A 3: 89,851,639 G355D probably benign Het
Snx11 C T 11: 96,774,458 E9K possibly damaging Het
Soat1 C A 1: 156,432,937 A444S probably benign Het
Sox6 T C 7: 115,486,662 Y690C probably damaging Het
Spata13 T A 14: 60,733,179 F10I probably benign Het
St18 C A 1: 6,802,905 T288K probably benign Het
Tifa C T 3: 127,796,586 S2F probably damaging Het
Tmem232 A T 17: 65,430,888 S392R probably benign Het
Tmtc3 T C 10: 100,466,220 N289S probably damaging Het
Tpo A G 12: 30,092,634 F697S probably damaging Het
Trp53 A G 11: 69,587,630 T122A probably damaging Het
Trps1 A C 15: 50,827,316 I10S probably benign Het
Tubgcp5 C T 7: 55,794,185 probably benign Het
Unc13c T G 9: 73,932,072 Y499S possibly damaging Het
Unc45a C A 7: 80,333,035 D381Y probably damaging Het
Upf1 G C 8: 70,339,368 H402Q probably benign Het
Uroc1 A T 6: 90,349,192 I510F possibly damaging Het
Usp15 A G 10: 123,127,757 F589L probably damaging Het
Vmn2r76 T C 7: 86,225,525 Y748C probably damaging Het
Wwp1 T C 4: 19,662,143 N151D probably benign Het
Zbtb40 A T 4: 137,001,216 S439T probably benign Het
Zbtb6 A T 2: 37,428,716 L400* probably null Het
Zfp125 C T 12: 20,899,960 noncoding transcript Het
Zmynd8 A C 2: 165,840,034 Y183* probably null Het
Other mutations in Greb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Greb1 APN 12 16711961 missense probably damaging 1.00
IGL01316:Greb1 APN 12 16698586 missense probably benign 0.04
IGL01464:Greb1 APN 12 16714826 missense probably damaging 0.99
IGL01474:Greb1 APN 12 16684501 missense probably benign
IGL01522:Greb1 APN 12 16701201 missense probably damaging 1.00
IGL01824:Greb1 APN 12 16711716 nonsense probably null
IGL01837:Greb1 APN 12 16684451 missense probably benign 0.19
IGL01991:Greb1 APN 12 16699681 missense probably damaging 1.00
IGL01996:Greb1 APN 12 16690845 missense possibly damaging 0.70
IGL02213:Greb1 APN 12 16706232 missense probably damaging 1.00
IGL02267:Greb1 APN 12 16717208 missense probably benign 0.00
IGL02512:Greb1 APN 12 16692712 missense possibly damaging 0.79
IGL02583:Greb1 APN 12 16706295 splice site probably benign
IGL02613:Greb1 APN 12 16739888 critical splice donor site probably null
IGL02648:Greb1 APN 12 16708682 missense probably damaging 1.00
IGL02679:Greb1 APN 12 16708723 missense probably damaging 1.00
Eared UTSW 12 16673863 missense probably damaging 1.00
Humpback UTSW 12 16701171 missense probably damaging 1.00
pied_billed UTSW 12 16724857 missense possibly damaging 0.79
IGL03048:Greb1 UTSW 12 16733331 missense probably damaging 1.00
R0083:Greb1 UTSW 12 16696451 missense probably benign
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0220:Greb1 UTSW 12 16682286 missense probably damaging 1.00
R0245:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0540:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0547:Greb1 UTSW 12 16723411 missense probably benign
R0563:Greb1 UTSW 12 16680267 missense probably benign 0.23
R0607:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0610:Greb1 UTSW 12 16696442 missense probably benign
R0652:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0659:Greb1 UTSW 12 16680212 missense probably damaging 0.99
R0945:Greb1 UTSW 12 16673802 missense probably benign 0.31
R1055:Greb1 UTSW 12 16682251 missense probably damaging 0.98
R1445:Greb1 UTSW 12 16707851 missense probably damaging 1.00
R1471:Greb1 UTSW 12 16711774 missense probably damaging 0.97
R1503:Greb1 UTSW 12 16724819 nonsense probably null
R1566:Greb1 UTSW 12 16711828 missense possibly damaging 0.94
R1614:Greb1 UTSW 12 16701171 missense probably damaging 1.00
R1623:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R1751:Greb1 UTSW 12 16723438 splice site probably benign
R1778:Greb1 UTSW 12 16690894 missense probably benign
R1842:Greb1 UTSW 12 16696243 missense probably damaging 1.00
R2040:Greb1 UTSW 12 16702650 missense probably damaging 1.00
R2153:Greb1 UTSW 12 16699532 missense probably damaging 1.00
R2178:Greb1 UTSW 12 16696387 missense probably damaging 1.00
R2194:Greb1 UTSW 12 16690908 missense probably benign 0.08
R2248:Greb1 UTSW 12 16680378 missense possibly damaging 0.90
R2474:Greb1 UTSW 12 16714953 missense possibly damaging 0.93
R2509:Greb1 UTSW 12 16724922 missense probably damaging 1.00
R2860:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2861:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2862:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2866:Greb1 UTSW 12 16699550 missense probably damaging 1.00
R2890:Greb1 UTSW 12 16704478 missense probably damaging 1.00
R3056:Greb1 UTSW 12 16688591 missense probably damaging 0.96
R3863:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3864:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3956:Greb1 UTSW 12 16682299 missense probably damaging 1.00
R4493:Greb1 UTSW 12 16698610 missense probably benign 0.14
R4548:Greb1 UTSW 12 16699675 missense probably damaging 1.00
R4683:Greb1 UTSW 12 16711773 missense possibly damaging 0.75
R4739:Greb1 UTSW 12 16696328 missense probably damaging 1.00
R4770:Greb1 UTSW 12 16681356 missense probably benign 0.03
R4925:Greb1 UTSW 12 16681471 missense probably damaging 1.00
R4982:Greb1 UTSW 12 16724761 missense probably damaging 0.98
R5009:Greb1 UTSW 12 16724857 missense possibly damaging 0.79
R5086:Greb1 UTSW 12 16708022 intron probably benign
R5213:Greb1 UTSW 12 16714790 nonsense probably null
R5310:Greb1 UTSW 12 16716759 missense probably benign 0.09
R5353:Greb1 UTSW 12 16688566 nonsense probably null
R5544:Greb1 UTSW 12 16673796 missense probably damaging 1.00
R5605:Greb1 UTSW 12 16708726 missense probably damaging 0.96
R5708:Greb1 UTSW 12 16673842 missense probably benign 0.11
R5837:Greb1 UTSW 12 16688585 missense probably damaging 1.00
R5890:Greb1 UTSW 12 16733421 missense possibly damaging 0.90
R5938:Greb1 UTSW 12 16717258 missense probably damaging 1.00
R6049:Greb1 UTSW 12 16681394 missense probably damaging 0.99
R6093:Greb1 UTSW 12 16684486 missense probably benign
R6120:Greb1 UTSW 12 16708621 missense probably damaging 0.99
R6175:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R6247:Greb1 UTSW 12 16716675 missense probably damaging 1.00
R6274:Greb1 UTSW 12 16735151 missense probably damaging 0.97
R6376:Greb1 UTSW 12 16699579 missense probably damaging 0.97
R6523:Greb1 UTSW 12 16684373 missense possibly damaging 0.51
R6557:Greb1 UTSW 12 16710383 missense probably benign 0.00
R6602:Greb1 UTSW 12 16709440 missense probably benign 0.44
R6621:Greb1 UTSW 12 16692717 missense probably damaging 1.00
R6645:Greb1 UTSW 12 16698579 missense probably benign 0.07
R6725:Greb1 UTSW 12 16688567 missense probably damaging 1.00
R6750:Greb1 UTSW 12 16688583 missense probably benign 0.05
R6863:Greb1 UTSW 12 16684420 missense probably damaging 1.00
R6914:Greb1 UTSW 12 16707902 missense probably damaging 0.97
R6996:Greb1 UTSW 12 16723354 missense probably benign 0.00
R7083:Greb1 UTSW 12 16723314 missense probably benign
R7147:Greb1 UTSW 12 16733427 missense probably damaging 1.00
R7238:Greb1 UTSW 12 16674672 missense probably damaging 0.99
R7290:Greb1 UTSW 12 16711738 missense probably damaging 1.00
R7358:Greb1 UTSW 12 16724881 missense probably damaging 1.00
R7395:Greb1 UTSW 12 16709430 critical splice donor site probably null
R7526:Greb1 UTSW 12 16716765 missense probably benign 0.00
R7530:Greb1 UTSW 12 16717206 missense probably benign 0.02
R7536:Greb1 UTSW 12 16682185 missense probably damaging 1.00
R7643:Greb1 UTSW 12 16711996 missense probably damaging 0.99
R7732:Greb1 UTSW 12 16673863 missense probably damaging 1.00
R7740:Greb1 UTSW 12 16740121 start gained probably benign
R7747:Greb1 UTSW 12 16674795 missense probably benign 0.01
R7760:Greb1 UTSW 12 16723416 missense probably benign
R8043:Greb1 UTSW 12 16711789 missense probably damaging 1.00
R8259:Greb1 UTSW 12 16724924 nonsense probably null
Z1176:Greb1 UTSW 12 16696756 missense probably benign 0.00
Z1177:Greb1 UTSW 12 16702491 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTACAGCAACTGTTACGGC -3'
(R):5'- ACTGTGACGCTAAGCTCTG -3'

Sequencing Primer
(F):5'- GATCTCATGTAGCCCAGATTGGAC -3'
(R):5'- GTGCTCTCCCCTCGCAC -3'
Posted On2016-03-16