Incidental Mutation 'R4843:Vps50'
ID374464
Institutional Source Beutler Lab
Gene Symbol Vps50
Ensembl Gene ENSMUSG00000001376
Gene NameVPS50 EARP/GARPII complex subunit
Synonyms8430415E05Rik, 1700034M03Rik, Ccdc132
MMRRC Submission 042456-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.882) question?
Stock #R4843 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location3498382-3603531 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 3536974 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000001412] [ENSMUST00000164052] [ENSMUST00000170873]
Predicted Effect probably null
Transcript: ENSMUST00000001412
SMART Domains Protein: ENSMUSP00000001412
Gene: ENSMUSG00000001376

DomainStartEndE-ValueType
Pfam:DUF2450 54 345 2.5e-112 PFAM
low complexity region 659 676 N/A INTRINSIC
Pfam:DUF2451 723 957 2.2e-98 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000164052
SMART Domains Protein: ENSMUSP00000125872
Gene: ENSMUSG00000001376

DomainStartEndE-ValueType
Pfam:DUF2450 54 345 5.2e-111 PFAM
low complexity region 659 676 N/A INTRINSIC
Pfam:DUF2451 723 929 1.1e-90 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170873
SMART Domains Protein: ENSMUSP00000128323
Gene: ENSMUSG00000001376

DomainStartEndE-ValueType
Pfam:DUF2450 54 345 5.3e-111 PFAM
low complexity region 659 676 N/A INTRINSIC
Pfam:DUF2451 723 933 2.6e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183935
Predicted Effect probably null
Transcript: ENSMUST00000185153
Meta Mutation Damage Score 0.9752 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 95% (58/61)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp1 T A 12: 30,896,145 K124* probably null Het
Actl11 G T 9: 107,929,492 C338F possibly damaging Het
Adam5 G A 8: 24,813,536 S125F probably damaging Het
Ap2s1 C A 7: 16,743,346 A44D possibly damaging Het
AW554918 T C 18: 25,340,000 V84A probably benign Het
Bsn G A 9: 108,107,189 T3222M unknown Het
Car15 A G 16: 17,836,608 Y155H possibly damaging Het
Cdca2 G T 14: 67,676,976 P945T probably damaging Het
Cdh16 A G 8: 104,621,540 F182L probably damaging Het
Cers6 G A 2: 69,068,659 A214T probably benign Het
Ces1g A T 8: 93,331,265 M136K probably damaging Het
Cnppd1 A G 1: 75,136,442 V394A probably benign Het
Cyp3a59 A T 5: 146,096,261 I148F possibly damaging Het
Dnah1 G A 14: 31,264,963 A3624V probably damaging Het
Exoc3l4 T C 12: 111,428,053 probably benign Het
Fap G T 2: 62,544,374 P227Q probably damaging Het
Fbxw10 G A 11: 62,847,325 R15H possibly damaging Het
Gm11011 T C 2: 169,587,320 probably benign Het
Gm11146 A C 16: 77,595,256 probably benign Het
Grip1 G A 10: 119,930,015 R84Q probably damaging Het
Hipk2 A G 6: 38,819,257 C19R possibly damaging Het
Hmgcll1 A G 9: 76,072,634 D102G possibly damaging Het
Ighv16-1 A T 12: 114,068,884 Y99* probably null Het
Kank1 T G 19: 25,431,007 S1283R probably damaging Het
Kcnip1 T A 11: 33,644,504 H95L probably benign Het
L3mbtl3 A T 10: 26,331,879 L314Q unknown Het
Marveld3 C A 8: 109,962,070 R13L possibly damaging Het
Mtrf1l G T 10: 5,823,696 P23Q possibly damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr494 G A 7: 108,368,143 A218T probably benign Het
Olfr786 G T 10: 129,437,447 V212L probably benign Het
Paqr7 A G 4: 134,506,967 Y45C probably damaging Het
Plod3 G A 5: 136,991,000 W428* probably null Het
Pnisr T A 4: 21,857,400 probably benign Het
Ppip5k1 C A 2: 121,326,887 R1046L probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Prmt5 A T 14: 54,516,125 I99N probably benign Het
Ripk2 T C 4: 16,155,073 T149A probably damaging Het
Rpf2 C A 10: 40,247,002 probably benign Het
Rtf1 T A 2: 119,705,536 D190E possibly damaging Het
Shank2 T A 7: 144,031,409 M49K probably benign Het
Snd1 T G 6: 28,668,643 V443G probably damaging Het
Spag9 T C 11: 94,097,818 F555L probably damaging Het
Srfbp1 A G 18: 52,488,677 K270R probably benign Het
Tenm2 T A 11: 36,024,020 N2230I probably damaging Het
Tmem106a T C 11: 101,586,195 probably benign Het
Tpsg1 A T 17: 25,370,617 probably benign Het
Trank1 A G 9: 111,366,078 S1057G probably benign Het
Unc13d G A 11: 116,074,259 T220M probably damaging Het
Vmn1r68 T C 7: 10,527,977 T65A probably benign Het
Washc5 A G 15: 59,350,371 I85T possibly damaging Het
Zfp677 C T 17: 21,392,526 T2I probably benign Het
Zxdc A G 6: 90,382,272 T629A possibly damaging Het
Other mutations in Vps50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Vps50 APN 6 3602670 missense probably benign 0.00
IGL00764:Vps50 APN 6 3532177 nonsense probably null
IGL00844:Vps50 APN 6 3532177 nonsense probably null
IGL00845:Vps50 APN 6 3532177 nonsense probably null
IGL00850:Vps50 APN 6 3532177 nonsense probably null
IGL01417:Vps50 APN 6 3522377 splice site probably benign
IGL01648:Vps50 APN 6 3498545 missense probably benign 0.25
IGL03238:Vps50 APN 6 3594771 missense possibly damaging 0.60
IGL03285:Vps50 APN 6 3555011 missense possibly damaging 0.71
R0309:Vps50 UTSW 6 3536853 missense possibly damaging 0.90
R0513:Vps50 UTSW 6 3520210 missense probably damaging 1.00
R0714:Vps50 UTSW 6 3571105 missense probably benign 0.05
R1066:Vps50 UTSW 6 3533565 missense probably damaging 1.00
R1210:Vps50 UTSW 6 3594884 missense probably damaging 0.99
R1420:Vps50 UTSW 6 3588007 nonsense probably null
R1437:Vps50 UTSW 6 3517852 nonsense probably null
R1451:Vps50 UTSW 6 3565628 missense possibly damaging 0.77
R1470:Vps50 UTSW 6 3517777 splice site probably benign
R1576:Vps50 UTSW 6 3545568 missense possibly damaging 0.60
R1599:Vps50 UTSW 6 3565537 missense probably benign 0.00
R1860:Vps50 UTSW 6 3520279 critical splice donor site probably null
R2055:Vps50 UTSW 6 3522265 missense probably benign 0.01
R2109:Vps50 UTSW 6 3555379 missense probably damaging 0.99
R3408:Vps50 UTSW 6 3600212 missense probably damaging 1.00
R3732:Vps50 UTSW 6 3519243 synonymous silent
R3764:Vps50 UTSW 6 3588063 missense probably damaging 1.00
R3828:Vps50 UTSW 6 3533500 missense probably benign
R4092:Vps50 UTSW 6 3551037 missense probably benign
R4385:Vps50 UTSW 6 3516694 missense probably benign 0.00
R4588:Vps50 UTSW 6 3562306 missense probably damaging 1.00
R4978:Vps50 UTSW 6 3517808 missense probably benign
R5368:Vps50 UTSW 6 3567739 missense possibly damaging 0.88
R5867:Vps50 UTSW 6 3536965 missense probably damaging 1.00
R6591:Vps50 UTSW 6 3504939 critical splice donor site probably null
R6626:Vps50 UTSW 6 3551101 nonsense probably null
R6691:Vps50 UTSW 6 3504939 critical splice donor site probably null
R6707:Vps50 UTSW 6 3545583 missense probably damaging 1.00
R6751:Vps50 UTSW 6 3600274 missense probably damaging 1.00
R6773:Vps50 UTSW 6 3592560 missense probably benign 0.25
R6867:Vps50 UTSW 6 3517835 missense probably benign 0.16
R6883:Vps50 UTSW 6 3498513 unclassified probably benign
R6963:Vps50 UTSW 6 3592577 critical splice donor site probably null
R7147:Vps50 UTSW 6 3567750 nonsense probably null
R7150:Vps50 UTSW 6 3578854 missense possibly damaging 0.89
R7167:Vps50 UTSW 6 3600256 missense probably damaging 1.00
R7235:Vps50 UTSW 6 3588078 missense probably benign 0.01
R7385:Vps50 UTSW 6 3602708 missense probably benign 0.00
R7662:Vps50 UTSW 6 3562304 missense probably damaging 1.00
R7782:Vps50 UTSW 6 3532202 critical splice donor site probably null
R8188:Vps50 UTSW 6 3562297 nonsense probably null
R8232:Vps50 UTSW 6 3600139 missense probably damaging 1.00
R8535:Vps50 UTSW 6 3565612 missense possibly damaging 0.95
X0025:Vps50 UTSW 6 3571012 missense probably benign 0.02
X0062:Vps50 UTSW 6 3594833 missense probably benign
Z1176:Vps50 UTSW 6 3578792 critical splice acceptor site probably null
Z1177:Vps50 UTSW 6 3555367 critical splice acceptor site probably null
Z1177:Vps50 UTSW 6 3562312 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCCGTGCTGTTGCTCTAG -3'
(R):5'- AAATATGTCCACTCCTCGCCTG -3'

Sequencing Primer
(F):5'- AGTCTGTTCTGTCTAGTCTTGAC -3'
(R):5'- CGCCTGCTTTCTAGGAAGAAC -3'
Posted On2016-03-16