Incidental Mutation 'R4844:Atad5'
ID374468
Institutional Source Beutler Lab
Gene Symbol Atad5
Ensembl Gene ENSMUSG00000017550
Gene NameATPase family, AAA domain containing 5
SynonymsLOC237877, C130052G03Rik
MMRRC Submission 042457-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4844 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location80089400-80135794 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 80114311 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017694] [ENSMUST00000108239] [ENSMUST00000108239]
Predicted Effect probably null
Transcript: ENSMUST00000017694
SMART Domains Protein: ENSMUSP00000017694
Gene: ENSMUSG00000017550

DomainStartEndE-ValueType
low complexity region 298 311 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
coiled coil region 665 697 N/A INTRINSIC
low complexity region 798 807 N/A INTRINSIC
AAA 1111 1347 5.14e-5 SMART
Blast:AAA 1409 1526 1e-31 BLAST
low complexity region 1573 1583 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108239
SMART Domains Protein: ENSMUSP00000103874
Gene: ENSMUSG00000017550

DomainStartEndE-ValueType
low complexity region 298 311 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
coiled coil region 665 697 N/A INTRINSIC
low complexity region 798 807 N/A INTRINSIC
AAA 1108 1344 5.14e-5 SMART
Blast:AAA 1406 1523 1e-31 BLAST
low complexity region 1570 1580 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108239
SMART Domains Protein: ENSMUSP00000103874
Gene: ENSMUSG00000017550

DomainStartEndE-ValueType
low complexity region 298 311 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
coiled coil region 665 697 N/A INTRINSIC
low complexity region 798 807 N/A INTRINSIC
AAA 1108 1344 5.14e-5 SMART
Blast:AAA 1406 1523 1e-31 BLAST
low complexity region 1570 1580 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151815
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (68/70)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit prenatal lethality. Mice heterozygous for a gene trap allele exhibit genomic instability, premature death, and a wide spectrum of spontaneous tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik A G 4: 35,213,565 V31A possibly damaging Het
Abcc9 T C 6: 142,689,098 T147A probably benign Het
Acvrl1 T C 15: 101,135,528 S99P probably damaging Het
Adamts3 T A 5: 89,677,816 S1055C probably damaging Het
Aftph T C 11: 20,708,667 probably benign Het
Aldh1a1 A G 19: 20,634,400 K363E probably benign Het
Astn2 A G 4: 65,644,730 V886A possibly damaging Het
Ccnf G T 17: 24,230,357 Y482* probably null Het
Cfap97 A G 8: 46,169,675 D34G possibly damaging Het
Chst11 G T 10: 83,191,089 E117* probably null Het
Cobl A T 11: 12,254,740 L572Q probably benign Het
Coch G A 12: 51,602,694 G263S probably damaging Het
Coq4 T C 2: 29,796,014 I205T possibly damaging Het
Cyp3a13 A T 5: 137,917,551 I62K probably benign Het
Cyp7a1 A G 4: 6,273,655 S84P probably damaging Het
Fam45a GTCT GT 19: 60,834,997 probably null Het
G6pc3 G A 11: 102,193,231 probably null Het
Gm10576 T C 4: 101,054,510 noncoding transcript Het
Gm17511 G A 7: 127,286,282 noncoding transcript Het
Gnat2 T C 3: 108,095,515 S80P probably damaging Het
Gpaa1 C T 15: 76,332,308 probably benign Het
Gpr107 T A 2: 31,188,674 probably null Het
Hormad1 T C 3: 95,570,931 Y103H probably damaging Het
Ighv14-1 T G 12: 113,932,002 Q101P probably damaging Het
Igsf9 A G 1: 172,497,170 D885G probably benign Het
Il15ra G A 2: 11,718,271 probably benign Het
Islr2 C T 9: 58,208,234 probably benign Het
Jak3 A T 8: 71,681,655 N467I possibly damaging Het
Jarid2 T C 13: 44,913,772 V1023A probably damaging Het
Kcnn2 A T 18: 45,683,120 T333S possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kmt2c T C 5: 25,315,113 T2000A probably benign Het
Lpxn A G 19: 12,833,172 T327A probably damaging Het
Mxra8 A G 4: 155,842,694 T362A probably benign Het
Myh6 A G 14: 54,947,194 I1560T possibly damaging Het
Ndufv1 A G 19: 4,012,574 S17P probably benign Het
Nwd1 A T 8: 72,667,114 H335L probably damaging Het
Olfr38 T A 6: 42,762,460 M136K probably damaging Het
Olfr403 A G 11: 74,196,076 D191G probably damaging Het
Otop2 G A 11: 115,323,375 probably null Het
Pwwp2b C A 7: 139,255,586 S314R probably benign Het
Rfx7 C T 9: 72,593,242 Q95* probably null Het
Serpine2 A T 1: 79,799,524 L192* probably null Het
Smpdl3b T C 4: 132,738,058 I322M probably damaging Het
Spata31d1b C T 13: 59,718,355 R1106C possibly damaging Het
Sprr2k T G 3: 92,429,425 probably null Het
St8sia1 T A 6: 142,829,270 R194S possibly damaging Het
Sv2a T A 3: 96,188,379 V337D probably damaging Het
Tars G A 15: 11,385,195 R637W possibly damaging Het
Tcp11l2 G T 10: 84,613,691 V507L probably benign Het
Tpr T C 1: 150,445,879 Y2262H possibly damaging Het
Vars A G 17: 35,011,612 E529G probably damaging Het
Vash2 C T 1: 190,978,494 probably benign Het
Vmn1r194 T C 13: 22,245,053 V280A probably benign Het
Vti1a A G 19: 55,391,865 T142A probably damaging Het
Zfp111 C T 7: 24,199,376 C270Y probably damaging Het
Zfp518a T A 19: 40,914,896 Y1090N probably damaging Het
Zfp616 A T 11: 74,084,399 Y498F probably benign Het
Other mutations in Atad5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Atad5 APN 11 80132858 missense probably benign 0.22
IGL00916:Atad5 APN 11 80119000 missense probably damaging 1.00
IGL01348:Atad5 APN 11 80095564 missense probably benign 0.00
IGL01601:Atad5 APN 11 80095517 missense probably benign 0.45
IGL01916:Atad5 APN 11 80112839 critical splice donor site probably null
IGL02028:Atad5 APN 11 80134110 missense probably benign 0.20
IGL02095:Atad5 APN 11 80094707 missense probably benign 0.24
IGL02142:Atad5 APN 11 80094197 missense probably benign 0.00
IGL02206:Atad5 APN 11 80094183 missense probably damaging 1.00
IGL02385:Atad5 APN 11 80094627 missense probably benign 0.04
IGL02858:Atad5 APN 11 80089775 missense probably damaging 1.00
IGL02962:Atad5 APN 11 80108579 missense possibly damaging 0.86
PIT4362001:Atad5 UTSW 11 80111567 missense probably benign 0.04
R0040:Atad5 UTSW 11 80098014 missense probably benign
R0157:Atad5 UTSW 11 80089817 missense possibly damaging 0.74
R0211:Atad5 UTSW 11 80095647 missense probably benign 0.00
R0211:Atad5 UTSW 11 80095647 missense probably benign 0.00
R0319:Atad5 UTSW 11 80120790 splice site probably benign
R0401:Atad5 UTSW 11 80120699 missense probably benign 0.11
R0426:Atad5 UTSW 11 80112832 missense probably benign 0.14
R0452:Atad5 UTSW 11 80106421 missense probably damaging 0.98
R0496:Atad5 UTSW 11 80100356 missense probably benign 0.08
R1691:Atad5 UTSW 11 80095532 missense probably benign 0.00
R1812:Atad5 UTSW 11 80133047 missense probably damaging 0.98
R2070:Atad5 UTSW 11 80098052 splice site probably null
R2071:Atad5 UTSW 11 80098052 splice site probably null
R2153:Atad5 UTSW 11 80106377 missense probably benign 0.04
R2415:Atad5 UTSW 11 80094251 missense probably damaging 1.00
R3917:Atad5 UTSW 11 80103294 missense probably null 0.97
R4025:Atad5 UTSW 11 80120686 missense probably damaging 1.00
R4464:Atad5 UTSW 11 80100311 splice site probably null
R4561:Atad5 UTSW 11 80095889 missense probably benign 0.01
R4579:Atad5 UTSW 11 80095191 missense probably damaging 1.00
R4853:Atad5 UTSW 11 80095272 missense probably damaging 1.00
R4873:Atad5 UTSW 11 80120689 missense probably damaging 1.00
R4875:Atad5 UTSW 11 80120689 missense probably damaging 1.00
R5054:Atad5 UTSW 11 80094676 missense probably benign 0.10
R5226:Atad5 UTSW 11 80095062 missense probably damaging 0.99
R5397:Atad5 UTSW 11 80111493 missense probably damaging 1.00
R5449:Atad5 UTSW 11 80124108 missense probably damaging 1.00
R5571:Atad5 UTSW 11 80111556 missense probably benign 0.05
R5575:Atad5 UTSW 11 80100323 missense probably benign 0.02
R5857:Atad5 UTSW 11 80131329 missense probably benign 0.06
R5927:Atad5 UTSW 11 80127285 missense probably damaging 1.00
R5928:Atad5 UTSW 11 80094177 missense probably damaging 1.00
R5949:Atad5 UTSW 11 80096009 nonsense probably null
R6102:Atad5 UTSW 11 80111572 critical splice donor site probably null
R6254:Atad5 UTSW 11 80127389 missense probably damaging 0.96
R6562:Atad5 UTSW 11 80133206 missense probably benign 0.26
R6744:Atad5 UTSW 11 80134032 missense probably benign 0.00
R7092:Atad5 UTSW 11 80120720 missense possibly damaging 0.68
R7202:Atad5 UTSW 11 80089775 missense probably damaging 1.00
R7345:Atad5 UTSW 11 80096006 missense probably damaging 1.00
R7352:Atad5 UTSW 11 80103343 critical splice donor site probably null
R7358:Atad5 UTSW 11 80133036 missense probably benign 0.32
R7420:Atad5 UTSW 11 80095862 missense probably benign 0.06
R7453:Atad5 UTSW 11 80119143 critical splice donor site probably null
R8012:Atad5 UTSW 11 80094240 missense probably damaging 1.00
R8152:Atad5 UTSW 11 80095170 missense possibly damaging 0.59
RF003:Atad5 UTSW 11 80111560 missense probably damaging 0.99
X0024:Atad5 UTSW 11 80132783 missense probably benign 0.02
Z1176:Atad5 UTSW 11 80094896 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCCACATGCACTCAGTG -3'
(R):5'- TTGATGTTAGAGTCTATGCCCTTC -3'

Sequencing Primer
(F):5'- CTTGCAATCCTAGCAGTTGGAAAGC -3'
(R):5'- GTCTATGCCCTTCGGATTTATTTTAC -3'
Posted On2016-03-16