Mutagenetix > Incidental Mutations

Incidental Mutation 'R0280:Sh3tc1'

37447

Institutional Source

Beutler Lab

Gene Symbol

Sh3tc1

Ensembl Gene

ENSMUSG00000036553

Gene Name

SH3 domain and tetratricopeptide repeats 1

Synonyms

MMRRC Submission

038502-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.078) question?

Stock #

R0280 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

35697180-35739987 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 35706017 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 942 (L942P)

Ref Sequence

ENSEMBL: ENSMUSP00000144175 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070203] [ENSMUST00000129664] [ENSMUST00000201511]

AlphaFold

G3X9F6

Predicted Effect

probably damaging
Transcript: ENSMUST00000070203
AA Change: L942P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000070610
Gene: ENSMUSG00000036553
AA Change: L942P

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
low complexity region	101	117	N/A	INTRINSIC
low complexity region	270	278	N/A	INTRINSIC
SH3	312	371	1.72e-6	SMART
low complexity region	381	397	N/A	INTRINSIC
low complexity region	422	434	N/A	INTRINSIC
low complexity region	541	552	N/A	INTRINSIC
TPR	565	598	3.41e1	SMART
Blast:TPR	607	639	2e-6	BLAST
TPR	668	701	3.37e-2	SMART
TPR	796	829	6.4e1	SMART
Blast:TPR	874	902	2e-6	BLAST
TPR	913	946	9.99e1	SMART
TPR	1202	1235	4.31e0	SMART
low complexity region	1266	1277	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127288

Predicted Effect

unknown
Transcript: ENSMUST00000127825
AA Change: L880P

SMART Domains

Protein: ENSMUSP00000115376
Gene: ENSMUSG00000036553
AA Change: L880P

Domain	Start	End	E-Value	Type
low complexity region	40	56	N/A	INTRINSIC
low complexity region	209	217	N/A	INTRINSIC
SH3	251	310	1.72e-6	SMART
low complexity region	320	336	N/A	INTRINSIC
low complexity region	361	373	N/A	INTRINSIC
low complexity region	480	491	N/A	INTRINSIC
TPR	504	537	3.41e1	SMART
Blast:TPR	546	578	2e-6	BLAST
TPR	607	640	3.37e-2	SMART
TPR	735	768	6.4e1	SMART
Blast:TPR	813	841	2e-6	BLAST
TPR	852	885	9.99e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000129664

SMART Domains

Protein: ENSMUSP00000119811
Gene: ENSMUSG00000036553

Domain	Start	End	E-Value	Type
low complexity region	34	42	N/A	INTRINSIC
SH3	76	130	2.41e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151555

Predicted Effect

probably damaging
Transcript: ENSMUST00000201511
AA Change: L942P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144175
Gene: ENSMUSG00000036553
AA Change: L942P

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
low complexity region	101	117	N/A	INTRINSIC
low complexity region	270	278	N/A	INTRINSIC
SH3	312	371	1.72e-6	SMART
low complexity region	381	397	N/A	INTRINSIC
low complexity region	422	434	N/A	INTRINSIC
low complexity region	541	552	N/A	INTRINSIC
TPR	565	598	3.41e1	SMART
Blast:TPR	607	639	2e-6	BLAST
TPR	668	701	3.37e-2	SMART
TPR	796	829	6.4e1	SMART
Blast:TPR	874	902	2e-6	BLAST
TPR	913	946	9.99e1	SMART
TPR	1202	1235	4.31e0	SMART
low complexity region	1266	1277	N/A	INTRINSIC

Meta Mutation Damage Score

0.8299

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.9%
20x: 94.6%

Validation Efficiency

96% (55/57)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
Adam18	C	T	8: 24,674,054	G38R	probably benign	Het
Ankrd16	T	G	2: 11,781,501	V187G	probably damaging	Het
AU019823	T	C	9: 50,609,379	T123A	probably damaging	Het
Ccdc110	A	T	8: 45,943,450	N793Y	probably benign	Het
Ccdc170	T	C	10: 4,558,663	I629T	possibly damaging	Het
Clcn6	A	G	4: 148,008,715	L836P	probably damaging	Het
Colgalt2	G	T	1: 152,508,561	A551S	possibly damaging	Het
Crocc	T	C	4: 141,028,426	E1097G	probably damaging	Het
Csmd1	A	T	8: 16,271,602	V494E	probably damaging	Het
Drg1	A	T	11: 3,256,537		probably null	Het
Dscam	T	C	16: 97,039,006	K134E	possibly damaging	Het
Dyrk1b	T	C	7: 28,184,312	Y198H	probably damaging	Het
Esr1	A	G	10: 4,856,951	D289G	probably benign	Het
Esr1	G	T	10: 4,939,289	V396F	probably damaging	Het
Evi5l	T	C	8: 4,193,133	V339A	probably damaging	Het
Fat4	A	T	3: 38,890,816	Q1286L	probably benign	Het
Frem1	T	C	4: 82,969,444	H1118R	probably damaging	Het
Fuk	A	T	8: 110,894,748	V188D	probably damaging	Het
Fut9	C	T	4: 25,619,852	D321N	probably benign	Het
Gaa	T	G	11: 119,284,547	V917G	probably damaging	Het
Gm973	GCC	GC	1: 59,544,680		probably null	Het
Kidins220	A	G	12: 25,010,141	T767A	probably damaging	Het
Kif7	A	G	7: 79,698,823	S1257P	probably benign	Het
Ltn1	A	G	16: 87,397,838	L1391P	probably damaging	Het
Mast3	A	G	8: 70,783,795	Y681H	probably damaging	Het
Mast3	A	G	8: 70,787,920	V291A	possibly damaging	Het
Metrn	C	T	17: 25,795,135	R239H	probably benign	Het
Mphosph10	C	A	7: 64,376,703	K666N	possibly damaging	Het
Mtbp	C	T	15: 55,586,461	T433I	probably benign	Het
Mtmr2	A	G	9: 13,799,249	K365E	probably damaging	Het
Nanog	A	G	6: 122,713,398	D229G	probably damaging	Het
Npepps	T	C	11: 97,241,014	N338S	possibly damaging	Het
Nphp4	T	A	4: 152,551,936		probably benign	Het
Olfr1279	T	C	2: 111,307,072	F289S	possibly damaging	Het
Plcl2	A	G	17: 50,607,034	E357G	probably damaging	Het
Polb	A	T	8: 22,640,392	Y173N	probably damaging	Het
R3hdm1	T	A	1: 128,162,775	S74T	probably benign	Het
Raet1d	T	A	10: 22,370,883	C37S	probably damaging	Het
Reln	G	A	5: 22,227,513		probably benign	Het
Rps6kc1	T	C	1: 190,809,000	S369G	probably damaging	Het
Sgf29	A	G	7: 126,671,571	E108G	probably benign	Het
Slc22a27	A	T	19: 7,896,822	L188*	probably null	Het
Slc9a3	T	A	13: 74,159,424	I445N	probably damaging	Het
Sufu	A	T	19: 46,450,673		probably benign	Het
Tomm40	G	A	7: 19,713,751	T118I	probably damaging	Het
Ttc25	A	T	11: 100,550,265	K107N	probably damaging	Het
Ttn	C	T	2: 76,740,479	R26690H	probably damaging	Het
Vmn2r16	A	G	5: 109,340,139	I293V	possibly damaging	Het
Vmn2r68	T	A	7: 85,233,249		probably benign	Het
Vmn2r68	C	G	7: 85,233,258		probably null	Het
Vsig8	A	G	1: 172,561,538	D119G	probably benign	Het

Other mutations in Sh3tc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Sh3tc1	APN	5	35710957	missense	probably damaging	1.00
IGL01019:Sh3tc1	APN	5	35703375	missense	probably damaging	1.00
IGL01725:Sh3tc1	APN	5	35700316	missense	probably benign	0.08
IGL02069:Sh3tc1	APN	5	35718995	missense	probably benign	0.45
IGL02153:Sh3tc1	APN	5	35703352	missense	probably damaging	1.00
IGL02269:Sh3tc1	APN	5	35706284	missense	probably benign	0.21
IGL02609:Sh3tc1	APN	5	35707172	missense	probably damaging	0.99
IGL02984:Sh3tc1	UTSW	5	35714059	splice site	probably null
R0305:Sh3tc1	UTSW	5	35723999	missense	probably benign
R0322:Sh3tc1	UTSW	5	35706561	missense	possibly damaging	0.86
R0485:Sh3tc1	UTSW	5	35702012	splice site	probably benign
R0511:Sh3tc1	UTSW	5	35703462	missense	probably damaging	1.00
R0513:Sh3tc1	UTSW	5	35700307	missense	possibly damaging	0.87
R0523:Sh3tc1	UTSW	5	35724066	small deletion	probably benign
R0550:Sh3tc1	UTSW	5	35699784	missense	probably damaging	0.99
R0676:Sh3tc1	UTSW	5	35719114	splice site	probably benign
R1485:Sh3tc1	UTSW	5	35719026	missense	probably benign	0.00
R1559:Sh3tc1	UTSW	5	35703349	critical splice donor site	probably null
R1599:Sh3tc1	UTSW	5	35707512	missense	probably benign	0.05
R1759:Sh3tc1	UTSW	5	35705904	missense	possibly damaging	0.95
R1808:Sh3tc1	UTSW	5	35705924	missense	probably benign	0.01
R1816:Sh3tc1	UTSW	5	35700584	critical splice donor site	probably null
R2036:Sh3tc1	UTSW	5	35716164	missense	probably benign	0.01
R2092:Sh3tc1	UTSW	5	35700658	missense	probably damaging	1.00
R2944:Sh3tc1	UTSW	5	35714160	missense	probably damaging	1.00
R4258:Sh3tc1	UTSW	5	35706978	missense	probably benign	0.00
R4556:Sh3tc1	UTSW	5	35707082	missense	probably damaging	1.00
R4647:Sh3tc1	UTSW	5	35706318	missense	probably damaging	1.00
R5011:Sh3tc1	UTSW	5	35700289	missense	probably damaging	1.00
R5740:Sh3tc1	UTSW	5	35707055	missense	probably benign	0.00
R6023:Sh3tc1	UTSW	5	35706951	nonsense	probably null
R6164:Sh3tc1	UTSW	5	35706246	missense	probably benign	0.05
R6262:Sh3tc1	UTSW	5	35699773	missense	probably damaging	1.00
R6433:Sh3tc1	UTSW	5	35706597	missense	probably damaging	0.99
R6932:Sh3tc1	UTSW	5	35707434	missense	probably benign	0.01
R6986:Sh3tc1	UTSW	5	35723944	missense	probably benign
R7098:Sh3tc1	UTSW	5	35702014	splice site	probably null
R7502:Sh3tc1	UTSW	5	35706062	missense	probably damaging	0.96
R7737:Sh3tc1	UTSW	5	35723953	missense	probably benign	0.15
R7792:Sh3tc1	UTSW	5	35710951	missense	probably damaging	0.97
R8079:Sh3tc1	UTSW	5	35706857	missense	possibly damaging	0.78
R8154:Sh3tc1	UTSW	5	35718352	missense	probably damaging	1.00
R8267:Sh3tc1	UTSW	5	35706407	missense	probably benign	0.01
R8300:Sh3tc1	UTSW	5	35697448	missense	probably benign	0.00
R8416:Sh3tc1	UTSW	5	35710912	missense	probably damaging	0.99
R8459:Sh3tc1	UTSW	5	35721589	missense	probably benign
R8699:Sh3tc1	UTSW	5	35701891	missense	probably damaging	1.00
R8754:Sh3tc1	UTSW	5	35706458	missense	probably benign	0.07
R8782:Sh3tc1	UTSW	5	35714204	missense	possibly damaging	0.93
R9044:Sh3tc1	UTSW	5	35697490	missense	possibly damaging	0.84
R9047:Sh3tc1	UTSW	5	35706483	missense	probably benign
R9092:Sh3tc1	UTSW	5	35716977	missense	probably benign	0.00
X0061:Sh3tc1	UTSW	5	35706809	missense	probably damaging	1.00
Z1176:Sh3tc1	UTSW	5	35714229	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- TGCTTTCTCAGAAGCCAGCATGAC -3'
(R):5'- GCTTTGTGGGAACAGCTTAGTAGCC -3'

Sequencing Primer
(F):5'- ACCCCAGGAGGAGGTGTG -3'
(R):5'- TGGACATCCTGAAGTGCATC -3'

Posted On

2013-05-23