Mutagenetix > Incidental Mutation

Incidental Mutation 'R4828:Herc1'

374484

Institutional Source

Beutler Lab

Gene Symbol

Herc1

Ensembl Gene

ENSMUSG00000038664

Gene Name

HECT and RLD domain containing E3 ubiquitin protein ligase family member 1

Synonyms

tbl, D130015N03Rik, 2810449H11Rik

MMRRC Submission

042444-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4828 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66350450-66508775 bp(+) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

G to A at 66497343 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000044801 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042824]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000042824

SMART Domains

Protein: ENSMUSP00000044801
Gene: ENSMUSG00000038664

Domain	Start	End	E-Value	Type
low complexity region	79	90	N/A	INTRINSIC
low complexity region	136	147	N/A	INTRINSIC
Pfam:RCC1	476	526	5.4e-15	PFAM
Pfam:RCC1_2	513	542	1.3e-9	PFAM
Pfam:RCC1	529	576	5.5e-16	PFAM
Pfam:RCC1	579	629	1.5e-10	PFAM
Pfam:RCC1	632	680	3.6e-9	PFAM
Pfam:RCC1_2	667	696	2.2e-11	PFAM
Pfam:RCC1	683	733	1.2e-14	PFAM
low complexity region	787	807	N/A	INTRINSIC
low complexity region	852	864	N/A	INTRINSIC
low complexity region	1014	1025	N/A	INTRINSIC
low complexity region	1080	1100	N/A	INTRINSIC
low complexity region	1348	1378	N/A	INTRINSIC
low complexity region	1659	1676	N/A	INTRINSIC
low complexity region	1865	1874	N/A	INTRINSIC
low complexity region	2002	2030	N/A	INTRINSIC
SPRY	2067	2188	1.8e-30	SMART
coiled coil region	2251	2280	N/A	INTRINSIC
low complexity region	2410	2423	N/A	INTRINSIC
low complexity region	2613	2629	N/A	INTRINSIC
low complexity region	2633	2648	N/A	INTRINSIC
low complexity region	2650	2667	N/A	INTRINSIC
low complexity region	2736	2749	N/A	INTRINSIC
low complexity region	2882	2896	N/A	INTRINSIC
low complexity region	2924	2935	N/A	INTRINSIC
low complexity region	2971	2987	N/A	INTRINSIC
low complexity region	3045	3051	N/A	INTRINSIC
low complexity region	3168	3186	N/A	INTRINSIC
low complexity region	3191	3213	N/A	INTRINSIC
low complexity region	3364	3379	N/A	INTRINSIC
WD40	3415	3454	1.68e-6	SMART
WD40	3570	3608	3.68e1	SMART
WD40	3613	3652	4.3e-1	SMART
WD40	3657	3702	3.17e-2	SMART
WD40	3734	3773	8.29e-6	SMART
low complexity region	3950	3964	N/A	INTRINSIC
Pfam:RCC1_2	4079	4111	7.3e-9	PFAM
Pfam:RCC1	4098	4147	3.4e-16	PFAM
Pfam:RCC1_2	4134	4163	1.8e-7	PFAM
Pfam:RCC1	4150	4199	7.2e-16	PFAM
Pfam:RCC1	4204	4252	6.1e-12	PFAM
Pfam:RCC1	4255	4304	2.4e-7	PFAM
Pfam:RCC1_2	4291	4320	5.8e-12	PFAM
Pfam:RCC1	4307	4356	8.9e-16	PFAM
Blast:HECTc	4389	4423	2e-11	BLAST
HECTc	4497	4846	8.2e-148	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130854

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135600

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

98% (106/108)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gen encodes a member of the HERC protein family. This protein stimulates guanine nucleotide exchange on ARF1 and Rab proteins. This protein may be involved in membrane transport processes. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for this spontaneous mutation exhibit an abnormal cerebellar Purkinje cell layer and Purkinje cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	A	T	7: 120,216,247	R239S	probably damaging	Het
Adat3	T	C	10: 80,607,047	S240P	probably benign	Het
Agbl5	G	A	5: 30,890,715	R111H	probably damaging	Het
Alg2	A	G	4: 47,471,563	V415A	probably benign	Het
Alpk2	T	C	18: 65,349,113	E141G	probably benign	Het
Ampd1	A	C	3: 103,081,097	T115P	probably damaging	Het
Ankrd12	A	G	17: 65,984,637	L1267P	probably damaging	Het
Arfgef3	A	T	10: 18,652,693	S315R	probably damaging	Het
Atp10d	A	C	5: 72,239,118	D222A	probably benign	Het
B9d1	A	G	11: 61,507,635	E47G	probably damaging	Het
Bag2	T	C	1: 33,746,887	D118G	probably damaging	Het
Bnip3l	G	T	14: 67,008,759	P9Q	probably damaging	Het
Casp8ap2	A	G	4: 32,639,807	N287S	probably benign	Het
Ccdc190	A	G	1: 169,933,896	D189G	probably damaging	Het
Ccdc88a	A	G	11: 29,463,210	K583E	probably damaging	Het
Cd84	A	T	1: 171,872,748	N144I	probably damaging	Het
Chrnd	A	G	1: 87,191,571		probably benign	Het
Clca3b	G	T	3: 144,844,512	T224K	probably benign	Het
Crcp	A	G	5: 130,059,762	T119A	probably damaging	Het
Cul2	T	C	18: 3,431,013	Y596H	probably damaging	Het
Dip2c	T	A	13: 9,560,679	W356R	probably damaging	Het
Dlc1	T	A	8: 36,850,246	Q425L	possibly damaging	Het
Dnah7b	T	A	1: 46,128,112	V588D	possibly damaging	Het
Dock4	G	T	12: 40,668,437	G245W	probably damaging	Het
Dpf3	A	G	12: 83,294,499	I160T	possibly damaging	Het
Dstyk	A	G	1: 132,434,137	T102A	probably benign	Het
Eif3d	A	T	15: 77,960,029	L425*	probably null	Het
Elac2	A	G	11: 64,995,327	E477G	probably damaging	Het
Ephb3	G	A	16: 21,214,995	R23H	possibly damaging	Het
Exd1	C	T	2: 119,520,326	A485T	probably benign	Het
Ext2	G	A	2: 93,795,767	T316I	probably benign	Het
Fbf1	A	G	11: 116,148,951	V694A	probably benign	Het
Fgg	G	A	3: 83,008,370		probably benign	Het
Flnb	G	A	14: 7,919,238	V1664I	probably benign	Het
Flnc	G	A	6: 29,455,167	D1932N	probably damaging	Het
Gm1818	A	T	12: 48,555,626		noncoding transcript	Het
Gnai1	G	A	5: 18,291,472	S151L	probably damaging	Het
Golph3l	G	A	3: 95,591,748	R67H	possibly damaging	Het
Grk5	T	A	19: 60,987,775	C42*	probably null	Het
Hey2	A	T	10: 30,834,183	H191Q	possibly damaging	Het
Il11	A	G	7: 4,776,482	V8A	probably benign	Het
Il23r	G	A	6: 67,431,651	P402L	probably benign	Het
Irf5	A	G	6: 29,531,141	N2S	probably damaging	Het
Lamb1	T	C	12: 31,298,930	Y606H	probably benign	Het
Larp4b	C	T	13: 9,170,898	R650C	probably damaging	Het
Lrpap1	T	C	5: 35,102,421	E111G	possibly damaging	Het
Lrrc36	T	A	8: 105,455,230	S388T	probably benign	Het
Med27	T	C	2: 29,377,938		probably benign	Het
Mrc1	T	G	2: 14,270,206	D439E	probably damaging	Het
Notch4	A	T	17: 34,570,060	E444D	probably damaging	Het
Nrm	G	A	17: 35,864,190	V137I	possibly damaging	Het
Nxpe5	T	A	5: 138,230,533	L4Q	possibly damaging	Het
Obscn	A	G	11: 59,086,670	V2052A	possibly damaging	Het
Oc90	A	T	15: 65,881,559	Y304N	probably damaging	Het
Olfr1046	T	A	2: 86,217,533	H59L	possibly damaging	Het
Olfr275	T	C	4: 52,826,138	V247A	probably damaging	Het
Olfr491	T	C	7: 108,317,470	V192A	probably benign	Het
Olfr653	T	A	7: 104,579,973	F109Y	possibly damaging	Het
Olfr888	T	C	9: 38,108,740	I13T	probably damaging	Het
Parp10	A	T	15: 76,243,081	I52N	probably benign	Het
Pdgfrb	C	A	18: 61,073,243	R608S	probably damaging	Het
Pecam1	A	G	11: 106,699,808	C47R	probably damaging	Het
Pirb	C	T	7: 3,717,603	G299S	probably benign	Het
Pkhd1l1	A	G	15: 44,529,405	E1712G	possibly damaging	Het
Plce1	T	C	19: 38,769,499	I1958T	probably damaging	Het
Plch2	C	T	4: 154,984,635	R1073Q	probably benign	Het
Pld5	A	C	1: 176,274,867	I3S	probably benign	Het
Polr1a	T	C	6: 71,966,401	W1207R	possibly damaging	Het
Polr2m	T	G	9: 71,483,768	I51L	possibly damaging	Het
Ppl	G	A	16: 5,104,926	R234C	probably damaging	Het
Ppp1r42	C	T	1: 9,999,411	R142H	probably benign	Het
Prokr1	A	G	6: 87,581,242	V387A	probably benign	Het
Prss23	A	T	7: 89,509,900	Y320*	probably null	Het
Ptprk	A	T	10: 28,560,054	M804L	probably damaging	Het
Rdh16f2	A	G	10: 127,874,954	S147G	probably benign	Het
Rgs7bp	T	C	13: 105,053,024	H89R	possibly damaging	Het
Rilpl2	G	T	5: 124,469,812	T115K	possibly damaging	Het
Rnf212	G	A	5: 108,729,468	S153F	probably damaging	Het
Rnf213	A	G	11: 119,416,629	D705G	possibly damaging	Het
Selenbp2	A	G	3: 94,704,119	N379S	probably benign	Het
Sema3e	G	A	5: 14,226,640	V312M	probably damaging	Het
Sh2d5	T	A	4: 138,258,255	L338Q	probably damaging	Het
Shank3	A	G	15: 89,500,199		probably benign	Het
Skor2	G	T	18: 76,860,418	G612C	probably damaging	Het
Slc22a16	A	G	10: 40,573,640	Y24C	probably damaging	Het
Slc4a1ap	T	A	5: 31,530,709	Y312*	probably null	Het
Slc5a7	A	T	17: 54,276,799	F488I	probably benign	Het
Snrnp200	A	G	2: 127,211,607	D130G	probably damaging	Het
Sorbs2	T	A	8: 45,741,615		probably benign	Het
Tmem91	T	G	7: 25,669,378	T161P	probably damaging	Het
Tpd52l1	G	A	10: 31,346,701	T99M	probably damaging	Het
Trps1	A	G	15: 50,660,677	*1036Q	probably null	Het
Tshr	A	T	12: 91,537,790	T501S	probably damaging	Het
Tubgcp3	T	C	8: 12,671,987	N15S	probably benign	Het
Unc5b	A	G	10: 60,772,348	S669P	possibly damaging	Het
Zfp970	A	G	2: 177,475,353	E240G	probably damaging	Het

Other mutations in Herc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Herc1	APN	9	66483966	missense	probably benign	0.02
IGL00159:Herc1	APN	9	66437682	missense	possibly damaging	0.94
IGL00486:Herc1	APN	9	66476120	missense	probably benign
IGL00717:Herc1	APN	9	66485002	missense	probably damaging	1.00
IGL00766:Herc1	APN	9	66450741	missense	probably damaging	1.00
IGL00776:Herc1	APN	9	66421038	missense	probably benign
IGL00987:Herc1	APN	9	66408052	missense	probably benign	0.07
IGL01090:Herc1	APN	9	66469175	nonsense	probably null
IGL01098:Herc1	APN	9	66461922	critical splice donor site	probably null
IGL01106:Herc1	APN	9	66476438	splice site	probably benign
IGL01120:Herc1	APN	9	66428880	missense	probably benign
IGL01359:Herc1	APN	9	66439268	missense	probably benign	0.01
IGL01360:Herc1	APN	9	66483699	missense	probably benign
IGL01364:Herc1	APN	9	66399361	missense	probably benign	0.00
IGL01470:Herc1	APN	9	66497636	missense	possibly damaging	0.94
IGL01670:Herc1	APN	9	66487060	missense	probably damaging	1.00
IGL01825:Herc1	APN	9	66399807	missense	probably benign	0.00
IGL01903:Herc1	APN	9	66386872	nonsense	probably null
IGL01988:Herc1	APN	9	66488075	splice site	probably benign
IGL02074:Herc1	APN	9	66450983	missense	probably benign
IGL02089:Herc1	APN	9	66480869	missense	probably damaging	1.00
IGL02177:Herc1	APN	9	66434511	missense	probably benign
IGL02300:Herc1	APN	9	66476363	missense	probably benign	0.01
IGL02304:Herc1	APN	9	66476414	missense	probably benign	0.06
IGL02369:Herc1	APN	9	66492011	nonsense	probably null
IGL02445:Herc1	APN	9	66433482	missense	possibly damaging	0.95
IGL02447:Herc1	APN	9	66497328	missense	possibly damaging	0.59
IGL02549:Herc1	APN	9	66399901	missense	probably damaging	0.98
IGL02571:Herc1	APN	9	66434605	splice site	probably benign
IGL02709:Herc1	APN	9	66497680	missense	probably damaging	0.97
IGL02717:Herc1	APN	9	66371921	nonsense	probably null
IGL02726:Herc1	APN	9	66441988	missense	probably benign	0.37
IGL02733:Herc1	APN	9	66450992	missense	probably benign
IGL02963:Herc1	APN	9	66388823	missense	probably damaging	0.99
IGL03101:Herc1	APN	9	66487997	missense	probably benign
IGL03193:Herc1	APN	9	66402680	missense	probably benign
IGL03203:Herc1	APN	9	66388900	critical splice donor site	probably null
IGL03216:Herc1	APN	9	66478946	missense	probably benign	0.06
IGL03282:Herc1	APN	9	66451459	missense	probably benign	0.05
IGL03295:Herc1	APN	9	66396703	missense	possibly damaging	0.56
cradle	UTSW	9	66483866	splice site	probably null
miracles	UTSW	9	66462837	nonsense	probably null
newton	UTSW	9	66467803	missense	probably damaging	1.00
R0907_Herc1_362	UTSW	9	66433428	missense	possibly damaging	0.94
R4427_Herc1_231	UTSW	9	66496005	missense	probably damaging	1.00
R5026_Herc1_363	UTSW	9	66486126	missense	probably benign	0.03
stables	UTSW	9	66479453	missense	probably benign	0.13
strangle	UTSW	9	66501188	frame shift	probably null
IGL03134:Herc1	UTSW	9	66434063	critical splice acceptor site	probably benign
PIT4243001:Herc1	UTSW	9	66372207	missense	probably benign	0.00
PIT4486001:Herc1	UTSW	9	66372389	missense	probably damaging	1.00
PIT4696001:Herc1	UTSW	9	66479009	missense	probably damaging	1.00
R0044:Herc1	UTSW	9	66448175	missense	probably benign	0.04
R0044:Herc1	UTSW	9	66448175	missense	probably benign	0.04
R0052:Herc1	UTSW	9	66400156	missense	probably damaging	0.99
R0114:Herc1	UTSW	9	66461846	missense	probably damaging	0.99
R0129:Herc1	UTSW	9	66448075	missense	probably damaging	1.00
R0131:Herc1	UTSW	9	66480910	missense	probably benign	0.00
R0131:Herc1	UTSW	9	66480910	missense	probably benign	0.00
R0132:Herc1	UTSW	9	66480910	missense	probably benign	0.00
R0158:Herc1	UTSW	9	66495921	nonsense	probably null
R0333:Herc1	UTSW	9	66464699	splice site	probably null
R0384:Herc1	UTSW	9	66481050	splice site	probably benign
R0419:Herc1	UTSW	9	66446074	splice site	probably benign
R0453:Herc1	UTSW	9	66399772	missense	probably benign	0.20
R0458:Herc1	UTSW	9	66476381	missense	probably benign	0.12
R0490:Herc1	UTSW	9	66484999	missense	probably damaging	1.00
R0506:Herc1	UTSW	9	66448159	missense	probably damaging	0.99
R0513:Herc1	UTSW	9	66445645	missense	possibly damaging	0.96
R0628:Herc1	UTSW	9	66450881	missense	probably benign	0.35
R0666:Herc1	UTSW	9	66484888	splice site	probably benign
R0674:Herc1	UTSW	9	66501192	missense	probably damaging	0.99
R0682:Herc1	UTSW	9	66481981	missense	possibly damaging	0.95
R0690:Herc1	UTSW	9	66386838	nonsense	probably null
R0701:Herc1	UTSW	9	66487950	missense	probably damaging	1.00
R0766:Herc1	UTSW	9	66504840	missense	probably damaging	1.00
R0850:Herc1	UTSW	9	66466670	missense	probably damaging	1.00
R0907:Herc1	UTSW	9	66433428	missense	possibly damaging	0.94
R0972:Herc1	UTSW	9	66372145	missense	probably damaging	1.00
R0976:Herc1	UTSW	9	66439878	missense	possibly damaging	0.74
R1027:Herc1	UTSW	9	66455968	missense	probably benign
R1200:Herc1	UTSW	9	66486124	missense	probably damaging	1.00
R1226:Herc1	UTSW	9	66416263	missense	probably benign	0.00
R1364:Herc1	UTSW	9	66400093	missense	probably damaging	1.00
R1395:Herc1	UTSW	9	66439181	missense	probably benign	0.13
R1432:Herc1	UTSW	9	66465469	missense	probably benign	0.13
R1440:Herc1	UTSW	9	66467803	missense	probably damaging	1.00
R1476:Herc1	UTSW	9	66508266	missense	probably damaging	1.00
R1590:Herc1	UTSW	9	66491953	splice site	probably benign
R1634:Herc1	UTSW	9	66473538	missense	possibly damaging	0.51
R1700:Herc1	UTSW	9	66450678	splice site	probably null
R1753:Herc1	UTSW	9	66469010	missense	probably damaging	1.00
R1753:Herc1	UTSW	9	66502084	critical splice donor site	probably null
R1796:Herc1	UTSW	9	66388856	nonsense	probably null
R1830:Herc1	UTSW	9	66497599	missense	possibly damaging	0.95
R1855:Herc1	UTSW	9	66391426	missense	possibly damaging	0.95
R1866:Herc1	UTSW	9	66450791	missense	probably damaging	1.00
R1894:Herc1	UTSW	9	66479461	missense	probably damaging	1.00
R1918:Herc1	UTSW	9	66476126	splice site	probably null
R1999:Herc1	UTSW	9	66486078	missense	probably benign	0.07
R2034:Herc1	UTSW	9	66441972	missense	probably benign	0.01
R2138:Herc1	UTSW	9	66470307	missense	possibly damaging	0.94
R2186:Herc1	UTSW	9	66439901	missense	probably benign	0.45
R2192:Herc1	UTSW	9	66465406	missense	probably damaging	0.99
R2312:Herc1	UTSW	9	66508281	nonsense	probably null
R2338:Herc1	UTSW	9	66428969	missense	possibly damaging	0.69
R3035:Herc1	UTSW	9	66483935	missense	possibly damaging	0.89
R3732:Herc1	UTSW	9	66445640	missense	probably damaging	1.00
R3732:Herc1	UTSW	9	66445640	missense	probably damaging	1.00
R3733:Herc1	UTSW	9	66445640	missense	probably damaging	1.00
R3917:Herc1	UTSW	9	66434466	missense	possibly damaging	0.94
R3953:Herc1	UTSW	9	66433793	nonsense	probably null
R4073:Herc1	UTSW	9	66418492	missense	probably benign	0.12
R4075:Herc1	UTSW	9	66418492	missense	probably benign	0.12
R4241:Herc1	UTSW	9	66448348	frame shift	probably null
R4260:Herc1	UTSW	9	66448348	frame shift	probably null
R4261:Herc1	UTSW	9	66448348	frame shift	probably null
R4300:Herc1	UTSW	9	66489406	missense	probably damaging	1.00
R4398:Herc1	UTSW	9	66479453	missense	probably benign	0.13
R4426:Herc1	UTSW	9	66496005	missense	probably damaging	1.00
R4427:Herc1	UTSW	9	66496005	missense	probably damaging	1.00
R4590:Herc1	UTSW	9	66437664	missense	probably damaging	0.97
R4630:Herc1	UTSW	9	66433714	splice site	probably null
R4656:Herc1	UTSW	9	66394711	missense	probably damaging	0.97
R4658:Herc1	UTSW	9	66479491	missense	possibly damaging	0.50
R4663:Herc1	UTSW	9	66433378	missense	probably damaging	0.98
R4675:Herc1	UTSW	9	66391458	missense	probably damaging	1.00
R4678:Herc1	UTSW	9	66416269	missense	probably benign	0.00
R4754:Herc1	UTSW	9	66501206	missense	probably benign	0.00
R4766:Herc1	UTSW	9	66441929	missense	probably benign	0.00
R4792:Herc1	UTSW	9	66495984	missense	possibly damaging	0.67
R4832:Herc1	UTSW	9	66495971	missense	probably benign	0.11
R4879:Herc1	UTSW	9	66462837	nonsense	probably null
R4948:Herc1	UTSW	9	66484902	missense	probably benign
R5021:Herc1	UTSW	9	66470326	missense	possibly damaging	0.48
R5022:Herc1	UTSW	9	66470326	missense	possibly damaging	0.48
R5023:Herc1	UTSW	9	66470326	missense	possibly damaging	0.48
R5024:Herc1	UTSW	9	66470326	missense	possibly damaging	0.48
R5025:Herc1	UTSW	9	66470326	missense	possibly damaging	0.48
R5026:Herc1	UTSW	9	66486126	missense	probably benign	0.03
R5027:Herc1	UTSW	9	66473529	missense	probably benign	0.01
R5027:Herc1	UTSW	9	66504618	missense	probably damaging	0.98
R5038:Herc1	UTSW	9	66476460	intron	probably benign
R5041:Herc1	UTSW	9	66429045	missense	possibly damaging	0.86
R5053:Herc1	UTSW	9	66470326	missense	possibly damaging	0.48
R5137:Herc1	UTSW	9	66448223	missense	probably benign
R5197:Herc1	UTSW	9	66448504	missense	probably damaging	0.99
R5207:Herc1	UTSW	9	66399869	nonsense	probably null
R5247:Herc1	UTSW	9	66434551	missense	probably benign	0.01
R5267:Herc1	UTSW	9	66461809	missense	probably damaging	1.00
R5274:Herc1	UTSW	9	66399409	missense	probably benign
R5375:Herc1	UTSW	9	66467887	missense	probably damaging	0.99
R5401:Herc1	UTSW	9	66502056	missense	probably damaging	1.00
R5560:Herc1	UTSW	9	66451119	missense	probably benign	0.02
R5566:Herc1	UTSW	9	66465537	missense	possibly damaging	0.95
R5577:Herc1	UTSW	9	66481981	missense	probably damaging	0.99
R5596:Herc1	UTSW	9	66434063	critical splice acceptor site	probably benign
R5665:Herc1	UTSW	9	66465435	missense	probably damaging	1.00
R5744:Herc1	UTSW	9	66508193	missense	probably damaging	1.00
R5802:Herc1	UTSW	9	66462878	missense	probably damaging	1.00
R5822:Herc1	UTSW	9	66445612	missense	probably benign	0.00
R5954:Herc1	UTSW	9	66451492	splice site	probably benign
R5977:Herc1	UTSW	9	66433322	missense	possibly damaging	0.77
R6022:Herc1	UTSW	9	66483685	missense	probably damaging	1.00
R6043:Herc1	UTSW	9	66408154	missense	probably benign
R6046:Herc1	UTSW	9	66445549	missense	probably damaging	0.99
R6089:Herc1	UTSW	9	66445532	missense	probably damaging	1.00
R6123:Herc1	UTSW	9	66497250	missense	probably damaging	0.97
R6155:Herc1	UTSW	9	66433423	missense	possibly damaging	0.95
R6190:Herc1	UTSW	9	66376381	missense	possibly damaging	0.56
R6220:Herc1	UTSW	9	66433788	missense	probably damaging	1.00
R6265:Herc1	UTSW	9	66372016	missense	probably benign	0.05
R6348:Herc1	UTSW	9	66487976	missense	possibly damaging	0.77
R6362:Herc1	UTSW	9	66471908	missense	probably damaging	1.00
R6394:Herc1	UTSW	9	66395059	missense	probably damaging	0.99
R6434:Herc1	UTSW	9	66486182	missense	probably damaging	0.99
R6483:Herc1	UTSW	9	66448529	missense	possibly damaging	0.64
R6607:Herc1	UTSW	9	66418567	missense	probably benign	0.02
R6633:Herc1	UTSW	9	66439252	nonsense	probably null
R6634:Herc1	UTSW	9	66437744	missense	probably benign
R6693:Herc1	UTSW	9	66478976	missense	probably damaging	0.99
R6695:Herc1	UTSW	9	66483866	splice site	probably null
R6748:Herc1	UTSW	9	66501188	frame shift	probably null
R6750:Herc1	UTSW	9	66501188	frame shift	probably null
R6751:Herc1	UTSW	9	66501188	frame shift	probably null
R6774:Herc1	UTSW	9	66501188	frame shift	probably null
R6785:Herc1	UTSW	9	66501188	frame shift	probably null
R6786:Herc1	UTSW	9	66501188	frame shift	probably null
R6856:Herc1	UTSW	9	66397898	missense	probably benign	0.05
R6966:Herc1	UTSW	9	66411065	missense	probably benign	0.07
R7020:Herc1	UTSW	9	66486078	missense	probably benign	0.07
R7109:Herc1	UTSW	9	66481889	missense	probably benign	0.03
R7122:Herc1	UTSW	9	66399774	missense	possibly damaging	0.69
R7209:Herc1	UTSW	9	66385032	missense	possibly damaging	0.95
R7222:Herc1	UTSW	9	66467499	missense	probably damaging	0.98
R7303:Herc1	UTSW	9	66450816	missense	possibly damaging	0.93
R7305:Herc1	UTSW	9	66461868	missense
R7438:Herc1	UTSW	9	66394756	missense	probably benign	0.00
R7535:Herc1	UTSW	9	66474853	missense	probably damaging	1.00
R7585:Herc1	UTSW	9	66445547	missense	probably damaging	1.00
R7603:Herc1	UTSW	9	66451383	nonsense	probably null
R7670:Herc1	UTSW	9	66416347	missense	probably damaging	0.99
R7705:Herc1	UTSW	9	66439834	missense	possibly damaging	0.86
R7723:Herc1	UTSW	9	66371876	missense	probably benign	0.24
R7730:Herc1	UTSW	9	66493190	small deletion	probably benign
R7880:Herc1	UTSW	9	66508224	missense	probably damaging	0.99
R7958:Herc1	UTSW	9	66486193	missense	probably damaging	1.00
R7976:Herc1	UTSW	9	66434270	missense	possibly damaging	0.94
R8006:Herc1	UTSW	9	66445560	nonsense	probably null
R8084:Herc1	UTSW	9	66475935	missense	probably benign	0.45
R8094:Herc1	UTSW	9	66493180	missense	probably damaging	0.98
R8099:Herc1	UTSW	9	66372140	missense	probably damaging	1.00
R8151:Herc1	UTSW	9	66433791	missense	probably damaging	0.98
R8159:Herc1	UTSW	9	66461721	missense	probably null
R8190:Herc1	UTSW	9	66418451	missense	probably benign	0.00
R8213:Herc1	UTSW	9	66450888	missense	probably damaging	0.99
R8230:Herc1	UTSW	9	66470316	missense	probably damaging	0.99
R8265:Herc1	UTSW	9	66386704	nonsense	probably null
R8270:Herc1	UTSW	9	66487950	missense	probably damaging	1.00
R8353:Herc1	UTSW	9	66508289	missense	possibly damaging	0.88
R8423:Herc1	UTSW	9	66508160	missense	probably damaging	0.99
R8506:Herc1	UTSW	9	66473581	missense	possibly damaging	0.52
R8523:Herc1	UTSW	9	66450942	missense	probably benign
R8530:Herc1	UTSW	9	66418628	missense	probably benign
R8545:Herc1	UTSW	9	66371975	nonsense	probably null
R8682:Herc1	UTSW	9	66462848	missense
R8720:Herc1	UTSW	9	66481823	missense	probably benign	0.38
R8792:Herc1	UTSW	9	66465486	missense	probably damaging	1.00
R8915:Herc1	UTSW	9	66411174	missense	probably damaging	1.00
R8964:Herc1	UTSW	9	66445590	missense	probably damaging	1.00
R9056:Herc1	UTSW	9	66473500	missense	probably benign	0.10
R9158:Herc1	UTSW	9	66469118	missense	probably benign	0.00
R9167:Herc1	UTSW	9	66504618	missense	possibly damaging	0.75
R9192:Herc1	UTSW	9	66414131	missense	probably benign	0.35
R9252:Herc1	UTSW	9	66402552	missense	probably damaging	1.00
R9260:Herc1	UTSW	9	66418409	nonsense	probably null
R9261:Herc1	UTSW	9	66504847	missense	probably damaging	0.98
R9430:Herc1	UTSW	9	66418503	nonsense	probably null
R9519:Herc1	UTSW	9	66400074	missense	probably damaging	0.97
R9563:Herc1	UTSW	9	66386911	critical splice donor site	probably null
R9589:Herc1	UTSW	9	66465558	missense	possibly damaging	0.95
R9600:Herc1	UTSW	9	66397312	missense	possibly damaging	0.95
R9659:Herc1	UTSW	9	66399903	missense	probably benign	0.03
R9740:Herc1	UTSW	9	66448514	missense	probably damaging	1.00
R9774:Herc1	UTSW	9	66464750	missense	probably null
R9781:Herc1	UTSW	9	66372722	missense	probably benign
R9788:Herc1	UTSW	9	66399903	missense	probably benign	0.03
RF023:Herc1	UTSW	9	66458334	missense
X0011:Herc1	UTSW	9	66400159	missense	probably benign	0.28
X0067:Herc1	UTSW	9	66448524	missense	probably benign	0.03
Z1176:Herc1	UTSW	9	66434576	missense	probably benign
Z1177:Herc1	UTSW	9	66458425	missense	probably null
Z1177:Herc1	UTSW	9	66471911	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGCACATCTCATTACAATGCTGG -3'
(R):5'- ATGGGCTTACACTTCCGTC -3'

Sequencing Primer
(F):5'- CTCATTACAATGCTGGAACATGGG -3'
(R):5'- GGAGTAATGTAACACAACTCTTCAC -3'

Posted On

2016-03-16