Incidental Mutation 'R0280:Tomm40'
ID 37450
Institutional Source Beutler Lab
Gene Symbol Tomm40
Ensembl Gene ENSMUSG00000002984
Gene Name translocase of outer mitochondrial membrane 40
Synonyms Tom40
MMRRC Submission 038502-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0280 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 19701313-19715438 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 19713751 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 118 (T118I)
Ref Sequence ENSEMBL: ENSMUSP00000104090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032555] [ENSMUST00000075447] [ENSMUST00000093552]
AlphaFold Q9QYA2
Predicted Effect probably damaging
Transcript: ENSMUST00000032555
AA Change: T118I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032555
Gene: ENSMUSG00000002984
AA Change: T118I

DomainStartEndE-ValueType
low complexity region 8 69 N/A INTRINSIC
Pfam:Porin_3 79 355 7.7e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075447
SMART Domains Protein: ENSMUSP00000074898
Gene: ENSMUSG00000062300

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IGv 49 133 3.59e-14 SMART
IG_like 159 249 5.31e1 SMART
IG_like 261 338 8.12e1 SMART
transmembrane domain 351 373 N/A INTRINSIC
low complexity region 455 478 N/A INTRINSIC
low complexity region 486 496 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093552
AA Change: T118I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104090
Gene: ENSMUSG00000002984
AA Change: T118I

DomainStartEndE-ValueType
low complexity region 8 69 N/A INTRINSIC
Pfam:Porin_3 79 355 1.5e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174476
Meta Mutation Damage Score 0.6870 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is localized in the outer membrane of the mitochondria. It is the channel-forming subunit of the translocase of the mitochondrial outer membrane (TOM) complex that is essential for import of protein precursors into mitochondria. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Adam18 C T 8: 24,674,054 G38R probably benign Het
Ankrd16 T G 2: 11,781,501 V187G probably damaging Het
AU019823 T C 9: 50,609,379 T123A probably damaging Het
Ccdc110 A T 8: 45,943,450 N793Y probably benign Het
Ccdc170 T C 10: 4,558,663 I629T possibly damaging Het
Clcn6 A G 4: 148,008,715 L836P probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crocc T C 4: 141,028,426 E1097G probably damaging Het
Csmd1 A T 8: 16,271,602 V494E probably damaging Het
Drg1 A T 11: 3,256,537 probably null Het
Dscam T C 16: 97,039,006 K134E possibly damaging Het
Dyrk1b T C 7: 28,184,312 Y198H probably damaging Het
Esr1 A G 10: 4,856,951 D289G probably benign Het
Esr1 G T 10: 4,939,289 V396F probably damaging Het
Evi5l T C 8: 4,193,133 V339A probably damaging Het
Fat4 A T 3: 38,890,816 Q1286L probably benign Het
Frem1 T C 4: 82,969,444 H1118R probably damaging Het
Fuk A T 8: 110,894,748 V188D probably damaging Het
Fut9 C T 4: 25,619,852 D321N probably benign Het
Gaa T G 11: 119,284,547 V917G probably damaging Het
Gm973 GCC GC 1: 59,544,680 probably null Het
Kidins220 A G 12: 25,010,141 T767A probably damaging Het
Kif7 A G 7: 79,698,823 S1257P probably benign Het
Ltn1 A G 16: 87,397,838 L1391P probably damaging Het
Mast3 A G 8: 70,783,795 Y681H probably damaging Het
Mast3 A G 8: 70,787,920 V291A possibly damaging Het
Metrn C T 17: 25,795,135 R239H probably benign Het
Mphosph10 C A 7: 64,376,703 K666N possibly damaging Het
Mtbp C T 15: 55,586,461 T433I probably benign Het
Mtmr2 A G 9: 13,799,249 K365E probably damaging Het
Nanog A G 6: 122,713,398 D229G probably damaging Het
Npepps T C 11: 97,241,014 N338S possibly damaging Het
Nphp4 T A 4: 152,551,936 probably benign Het
Olfr1279 T C 2: 111,307,072 F289S possibly damaging Het
Plcl2 A G 17: 50,607,034 E357G probably damaging Het
Polb A T 8: 22,640,392 Y173N probably damaging Het
R3hdm1 T A 1: 128,162,775 S74T probably benign Het
Raet1d T A 10: 22,370,883 C37S probably damaging Het
Reln G A 5: 22,227,513 probably benign Het
Rps6kc1 T C 1: 190,809,000 S369G probably damaging Het
Sgf29 A G 7: 126,671,571 E108G probably benign Het
Sh3tc1 A G 5: 35,706,017 L942P probably damaging Het
Slc22a27 A T 19: 7,896,822 L188* probably null Het
Slc9a3 T A 13: 74,159,424 I445N probably damaging Het
Sufu A T 19: 46,450,673 probably benign Het
Ttc25 A T 11: 100,550,265 K107N probably damaging Het
Ttn C T 2: 76,740,479 R26690H probably damaging Het
Vmn2r16 A G 5: 109,340,139 I293V possibly damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Vsig8 A G 1: 172,561,538 D119G probably benign Het
Other mutations in Tomm40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Tomm40 APN 7 19703363 missense probably benign 0.13
IGL01766:Tomm40 APN 7 19703082 missense possibly damaging 0.93
IGL02831:Tomm40 APN 7 19703089 missense probably damaging 1.00
IGL03178:Tomm40 APN 7 19701834 missense probably damaging 0.98
PIT4131001:Tomm40 UTSW 7 19703091 missense probably damaging 1.00
R1842:Tomm40 UTSW 7 19713725 missense probably benign 0.41
R1913:Tomm40 UTSW 7 19710961 missense probably damaging 0.98
R3702:Tomm40 UTSW 7 19713673 missense possibly damaging 0.89
R4685:Tomm40 UTSW 7 19701836 missense probably benign 0.06
R5165:Tomm40 UTSW 7 19713667 critical splice donor site probably null
R5380:Tomm40 UTSW 7 19701750 missense probably benign 0.27
R6026:Tomm40 UTSW 7 19710964 missense probably benign 0.43
R6236:Tomm40 UTSW 7 19703356 missense probably benign 0.15
R6994:Tomm40 UTSW 7 19702906 missense probably damaging 0.98
R7206:Tomm40 UTSW 7 19710936 missense probably benign 0.10
R7530:Tomm40 UTSW 7 19702904 missense possibly damaging 0.82
R8419:Tomm40 UTSW 7 19701834 missense probably damaging 0.98
R8698:Tomm40 UTSW 7 19710965 missense probably benign 0.00
R8709:Tomm40 UTSW 7 19710778 missense possibly damaging 0.76
Z1176:Tomm40 UTSW 7 19703094 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- AACACCTTGGCTGCTCACTTGC -3'
(R):5'- ATTCAGATAGCACTCCAATGGCACC -3'

Sequencing Primer
(F):5'- GCTGCTCACTTGCTCACC -3'
(R):5'- TCAAGAATTCCAGGGTGACTAC -3'
Posted On 2013-05-23