Incidental Mutation 'R0280:Mphosph10'
ID 37452
Institutional Source Beutler Lab
Gene Symbol Mphosph10
Ensembl Gene ENSMUSG00000030521
Gene Name M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)
MMRRC Submission 038502-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock # R0280 (G1)
Quality Score 214
Status Validated
Chromosome 7
Chromosomal Location 64376527-64392268 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 64376703 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 666 (K666N)
Ref Sequence ENSEMBL: ENSMUSP00000032735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032735] [ENSMUST00000163289]
AlphaFold Q810V0
Predicted Effect possibly damaging
Transcript: ENSMUST00000032735
AA Change: K666N

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032735
Gene: ENSMUSG00000030521
AA Change: K666N

Pfam:Mpp10 20 654 6.9e-217 PFAM
low complexity region 666 671 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163289
SMART Domains Protein: ENSMUSP00000130012
Gene: ENSMUSG00000033458

SCOP:d1ihga1 600 737 5e-5 SMART
Blast:VRR_NUC 834 867 2e-12 BLAST
VRR_NUC 896 1011 1.99e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206778
Meta Mutation Damage Score 0.0718 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is phosphorylated during mitosis. The protein localizes to the nucleolus during interphase and to the chromosomes during M phase. The protein associates with the U3 small nucleolar ribonucleoprotein 60-80S complexes and may be involved in pre-rRNA processing. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Adam18 C T 8: 24,674,054 G38R probably benign Het
Ankrd16 T G 2: 11,781,501 V187G probably damaging Het
AU019823 T C 9: 50,609,379 T123A probably damaging Het
Ccdc110 A T 8: 45,943,450 N793Y probably benign Het
Ccdc170 T C 10: 4,558,663 I629T possibly damaging Het
Clcn6 A G 4: 148,008,715 L836P probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crocc T C 4: 141,028,426 E1097G probably damaging Het
Csmd1 A T 8: 16,271,602 V494E probably damaging Het
Drg1 A T 11: 3,256,537 probably null Het
Dscam T C 16: 97,039,006 K134E possibly damaging Het
Dyrk1b T C 7: 28,184,312 Y198H probably damaging Het
Esr1 A G 10: 4,856,951 D289G probably benign Het
Esr1 G T 10: 4,939,289 V396F probably damaging Het
Evi5l T C 8: 4,193,133 V339A probably damaging Het
Fat4 A T 3: 38,890,816 Q1286L probably benign Het
Frem1 T C 4: 82,969,444 H1118R probably damaging Het
Fuk A T 8: 110,894,748 V188D probably damaging Het
Fut9 C T 4: 25,619,852 D321N probably benign Het
Gaa T G 11: 119,284,547 V917G probably damaging Het
Gm973 GCC GC 1: 59,544,680 probably null Het
Kidins220 A G 12: 25,010,141 T767A probably damaging Het
Kif7 A G 7: 79,698,823 S1257P probably benign Het
Ltn1 A G 16: 87,397,838 L1391P probably damaging Het
Mast3 A G 8: 70,783,795 Y681H probably damaging Het
Mast3 A G 8: 70,787,920 V291A possibly damaging Het
Metrn C T 17: 25,795,135 R239H probably benign Het
Mtbp C T 15: 55,586,461 T433I probably benign Het
Mtmr2 A G 9: 13,799,249 K365E probably damaging Het
Nanog A G 6: 122,713,398 D229G probably damaging Het
Npepps T C 11: 97,241,014 N338S possibly damaging Het
Nphp4 T A 4: 152,551,936 probably benign Het
Olfr1279 T C 2: 111,307,072 F289S possibly damaging Het
Plcl2 A G 17: 50,607,034 E357G probably damaging Het
Polb A T 8: 22,640,392 Y173N probably damaging Het
R3hdm1 T A 1: 128,162,775 S74T probably benign Het
Raet1d T A 10: 22,370,883 C37S probably damaging Het
Reln G A 5: 22,227,513 probably benign Het
Rps6kc1 T C 1: 190,809,000 S369G probably damaging Het
Sgf29 A G 7: 126,671,571 E108G probably benign Het
Sh3tc1 A G 5: 35,706,017 L942P probably damaging Het
Slc22a27 A T 19: 7,896,822 L188* probably null Het
Slc9a3 T A 13: 74,159,424 I445N probably damaging Het
Sufu A T 19: 46,450,673 probably benign Het
Tomm40 G A 7: 19,713,751 T118I probably damaging Het
Ttc25 A T 11: 100,550,265 K107N probably damaging Het
Ttn C T 2: 76,740,479 R26690H probably damaging Het
Vmn2r16 A G 5: 109,340,139 I293V possibly damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Vsig8 A G 1: 172,561,538 D119G probably benign Het
Other mutations in Mphosph10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Mphosph10 APN 7 64389755 missense probably benign 0.00
IGL02113:Mphosph10 APN 7 64376807 unclassified probably benign
IGL02615:Mphosph10 APN 7 64381045 splice site probably benign
R0372:Mphosph10 UTSW 7 64388855 unclassified probably benign
R0503:Mphosph10 UTSW 7 64389893 missense probably benign
R0548:Mphosph10 UTSW 7 64378800 missense probably benign 0.45
R1158:Mphosph10 UTSW 7 64388859 unclassified probably benign
R1271:Mphosph10 UTSW 7 64390084 splice site probably null
R1447:Mphosph10 UTSW 7 64380950 missense probably damaging 1.00
R1501:Mphosph10 UTSW 7 64389504 missense probably damaging 1.00
R1815:Mphosph10 UTSW 7 64392170 missense probably benign 0.05
R1900:Mphosph10 UTSW 7 64381028 missense possibly damaging 0.61
R1997:Mphosph10 UTSW 7 64387447 critical splice donor site probably null
R2058:Mphosph10 UTSW 7 64376751 missense probably damaging 1.00
R2059:Mphosph10 UTSW 7 64376751 missense probably damaging 1.00
R2292:Mphosph10 UTSW 7 64385771 missense probably damaging 1.00
R4658:Mphosph10 UTSW 7 64388974 splice site probably null
R4817:Mphosph10 UTSW 7 64392221 unclassified probably benign
R4968:Mphosph10 UTSW 7 64382908 missense probably damaging 1.00
R5121:Mphosph10 UTSW 7 64389596 missense probably damaging 1.00
R5187:Mphosph10 UTSW 7 64385820 missense possibly damaging 0.49
R5304:Mphosph10 UTSW 7 64388984 missense probably damaging 1.00
R5469:Mphosph10 UTSW 7 64389445 critical splice donor site probably null
R6179:Mphosph10 UTSW 7 64378781 missense possibly damaging 0.66
R6360:Mphosph10 UTSW 7 64389955 missense probably benign 0.00
R6632:Mphosph10 UTSW 7 64385819 missense probably damaging 1.00
R6996:Mphosph10 UTSW 7 64388921 missense probably benign 0.07
R8531:Mphosph10 UTSW 7 64384328 missense possibly damaging 0.66
R8844:Mphosph10 UTSW 7 64377339 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- aatgaccgacaaaggcaaag -3'
Posted On 2013-05-23