Incidental Mutation 'R4847:Atad2b'
ID 374521
Institutional Source Beutler Lab
Gene Symbol Atad2b
Ensembl Gene ENSMUSG00000052812
Gene Name ATPase family, AAA domain containing 2B
Synonyms D530031C13Rik, 1110014E10Rik
MMRRC Submission 042460-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4847 (G1)
Quality Score 223
Status Not validated
Chromosome 12
Chromosomal Location 4917353-5047394 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 4944901 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000047445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045664]
AlphaFold E9Q166
Predicted Effect probably null
Transcript: ENSMUST00000045664
SMART Domains Protein: ENSMUSP00000047445
Gene: ENSMUSG00000052812

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 252 278 N/A INTRINSIC
AAA 432 573 4.56e-20 SMART
SCOP:d1e32a2 771 912 3e-4 SMART
BROMO 958 1070 4.24e-20 SMART
low complexity region 1135 1144 N/A INTRINSIC
low complexity region 1230 1253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219187
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AAA ATPase family. This family member includes an N-terminal bromodomain. It has been found to be localized to the nucleus, partly to replication sites, consistent with a chromatin-related function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced body size and fertility in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik C T 11: 80,374,114 V171M probably damaging Het
Abhd3 A G 18: 10,647,786 S328P possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aldh1b1 G T 4: 45,802,625 K54N possibly damaging Het
Amacr C T 15: 10,994,872 Q257* probably null Het
Ankrd12 A T 17: 66,024,092 D309E probably benign Het
Anks6 T C 4: 47,033,266 T600A probably benign Het
Ap3b1 A G 13: 94,471,779 E586G probably benign Het
Cant1 G A 11: 118,410,110 Q240* probably null Het
Casc1 T A 6: 145,175,185 H636L probably damaging Het
Cep152 T C 2: 125,618,474 Y186C possibly damaging Het
Cep76 C A 18: 67,619,569 R603I probably benign Het
Chad T C 11: 94,568,327 S352P probably benign Het
Ckap2 T C 8: 22,175,068 E460G probably damaging Het
Col22a1 T C 15: 71,799,499 Y1004C unknown Het
Col9a3 G A 2: 180,615,525 G480S probably damaging Het
Cpsf2 A G 12: 101,997,302 D430G probably benign Het
Cramp1l T C 17: 24,985,089 D305G probably damaging Het
Ctnnd1 C A 2: 84,622,052 E76* probably null Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2c39 A T 19: 39,560,896 N286I probably damaging Het
Ddx11 A G 17: 66,130,801 E174G probably damaging Het
Ddx19a T C 8: 110,977,045 E369G probably damaging Het
Epha1 T A 6: 42,361,914 D687V possibly damaging Het
Fgr T C 4: 132,994,648 W132R probably damaging Het
Fras1 A T 5: 96,544,992 D170V possibly damaging Het
Gas2l1 A G 11: 5,064,173 S96P probably damaging Het
Gfy G A 7: 45,177,596 P359S probably damaging Het
Hexim2 A G 11: 103,138,941 N273S probably benign Het
Hr A T 14: 70,556,476 T59S probably benign Het
Impdh2 A G 9: 108,564,671 Y166C probably damaging Het
Impdh2 T A 9: 108,565,515 F514Y probably benign Het
Iqgap2 A G 13: 95,673,743 F731S probably benign Het
Klhl17 A T 4: 156,231,597 H433Q probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kntc1 A C 5: 123,802,274 N1645T probably benign Het
Mcm8 A G 2: 132,820,003 I114V probably benign Het
Mink1 T A 11: 70,602,028 L160Q probably damaging Het
Mipol1 A T 12: 57,303,496 S27C probably damaging Het
Mthfr T C 4: 148,048,139 V217A probably damaging Het
Olfr1458 A G 19: 13,102,534 Y257H probably damaging Het
Olfr473 T A 7: 107,933,827 C102* probably null Het
Pde1c T C 6: 56,123,034 K614E possibly damaging Het
Pds5b A T 5: 150,748,112 E407V probably damaging Het
Pdzph1 A G 17: 58,973,530 S586P possibly damaging Het
Prkcb C T 7: 122,568,149 R361W probably benign Het
Psen2 T A 1: 180,245,632 probably null Het
Ptk2 T A 15: 73,231,956 M82L probably benign Het
Ptk2b T C 14: 66,173,882 D400G probably damaging Het
Samd8 G A 14: 21,792,435 R275Q possibly damaging Het
Senp2 A G 16: 22,038,636 T403A possibly damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Skap2 T A 6: 52,003,669 I52L probably benign Het
Slc5a7 T C 17: 54,277,140 D374G possibly damaging Het
Slmap A T 14: 26,426,608 L699M possibly damaging Het
Sntg1 A C 1: 8,595,482 C203G possibly damaging Het
Stard9 T C 2: 120,703,113 S3284P probably benign Het
Tbx21 T C 11: 97,115,031 Y36C probably damaging Het
Tecpr2 A G 12: 110,939,877 Y971C probably damaging Het
Trpm5 T A 7: 143,087,763 I137F possibly damaging Het
Ttc30a2 A T 2: 75,977,714 N151K probably benign Het
Unk A G 11: 116,054,406 K426E probably damaging Het
Zc3hc1 T C 6: 30,375,982 D193G probably benign Het
Other mutations in Atad2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Atad2b APN 12 5024593 missense probably damaging 1.00
IGL00917:Atad2b APN 12 4965837 unclassified probably benign
IGL01011:Atad2b APN 12 4965984 missense probably benign 0.01
IGL01092:Atad2b APN 12 5017987 missense probably damaging 0.98
IGL01604:Atad2b APN 12 4965837 unclassified probably benign
IGL01924:Atad2b APN 12 5034093 missense probably damaging 1.00
IGL02197:Atad2b APN 12 5018056 missense possibly damaging 0.84
IGL02397:Atad2b APN 12 4974046 missense probably damaging 1.00
IGL02404:Atad2b APN 12 4941972 missense probably benign 0.08
IGL02517:Atad2b APN 12 5018037 missense probably benign 0.07
IGL02726:Atad2b APN 12 4974003 nonsense probably null
IGL02896:Atad2b APN 12 4958151 missense probably damaging 1.00
IGL03227:Atad2b APN 12 5006715 missense probably damaging 1.00
IGL03265:Atad2b APN 12 5024628 missense probably benign 0.24
Plyers UTSW 12 4973970 missense probably damaging 1.00
Smidge UTSW 12 4990949 missense probably damaging 1.00
Tensor UTSW 12 4957558 missense probably damaging 1.00
Traction UTSW 12 5027182 critical splice donor site probably null
Vice UTSW 12 5018002 missense probably damaging 1.00
K3955:Atad2b UTSW 12 4954536 splice site probably benign
P0038:Atad2b UTSW 12 4954536 splice site probably benign
PIT4418001:Atad2b UTSW 12 5024587 missense probably benign 0.07
PIT4431001:Atad2b UTSW 12 5031795 missense possibly damaging 0.77
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0124:Atad2b UTSW 12 4952676 missense probably benign 0.23
R0462:Atad2b UTSW 12 4941973 missense possibly damaging 0.79
R0483:Atad2b UTSW 12 4945035 splice site probably benign
R0617:Atad2b UTSW 12 4937401 missense probably benign 0.43
R0894:Atad2b UTSW 12 4965915 missense probably damaging 1.00
R0942:Atad2b UTSW 12 5024591 missense probably damaging 1.00
R0960:Atad2b UTSW 12 5006593 splice site probably benign
R0973:Atad2b UTSW 12 5031784 missense probably benign 0.00
R1306:Atad2b UTSW 12 4974239 missense probably benign 0.08
R1530:Atad2b UTSW 12 4942018 nonsense probably null
R1678:Atad2b UTSW 12 4965899 missense possibly damaging 0.91
R1689:Atad2b UTSW 12 5034575 nonsense probably null
R1826:Atad2b UTSW 12 4974094 missense probably benign 0.00
R1996:Atad2b UTSW 12 4990883 missense probably benign 0.01
R2233:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2235:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2943:Atad2b UTSW 12 4942067 missense probably damaging 0.98
R3161:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3508:Atad2b UTSW 12 4950595 critical splice donor site probably null
R4239:Atad2b UTSW 12 4985710 missense probably benign 0.05
R4401:Atad2b UTSW 12 4940145 missense probably damaging 0.99
R4558:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4559:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4573:Atad2b UTSW 12 4954663 splice site probably null
R4639:Atad2b UTSW 12 5018053 missense probably damaging 1.00
R4850:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4851:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4979:Atad2b UTSW 12 5034513 missense probably damaging 1.00
R5024:Atad2b UTSW 12 4937534 missense probably benign 0.45
R5305:Atad2b UTSW 12 4965855 missense probably damaging 1.00
R5405:Atad2b UTSW 12 4940098 missense possibly damaging 0.87
R5627:Atad2b UTSW 12 4917911 missense probably benign 0.01
R5754:Atad2b UTSW 12 5010351 missense probably benign 0.01
R6163:Atad2b UTSW 12 4954593 missense probably benign 0.00
R6371:Atad2b UTSW 12 4973970 missense probably damaging 1.00
R6374:Atad2b UTSW 12 5018002 missense probably damaging 1.00
R6399:Atad2b UTSW 12 4957558 missense probably damaging 1.00
R6433:Atad2b UTSW 12 4952642 missense possibly damaging 0.89
R6546:Atad2b UTSW 12 4990949 missense probably damaging 1.00
R6617:Atad2b UTSW 12 5024668 missense probably benign 0.00
R7199:Atad2b UTSW 12 5017992 missense probably damaging 1.00
R7267:Atad2b UTSW 12 5027105 nonsense probably null
R7405:Atad2b UTSW 12 4943232 missense probably benign 0.08
R7460:Atad2b UTSW 12 4952660 missense probably benign 0.28
R7568:Atad2b UTSW 12 5010390 critical splice donor site probably null
R7593:Atad2b UTSW 12 5031726 missense probably benign 0.16
R7648:Atad2b UTSW 12 5027182 critical splice donor site probably null
R8253:Atad2b UTSW 12 4974159 missense possibly damaging 0.54
R8253:Atad2b UTSW 12 4974160 missense probably benign 0.02
R8708:Atad2b UTSW 12 4961253 missense probably damaging 1.00
R8894:Atad2b UTSW 12 5014001 critical splice donor site probably null
R8948:Atad2b UTSW 12 4991012 missense possibly damaging 0.87
R8976:Atad2b UTSW 12 4917923 critical splice donor site probably null
R9052:Atad2b UTSW 12 4965982 missense probably damaging 1.00
R9057:Atad2b UTSW 12 5018102 nonsense probably null
R9134:Atad2b UTSW 12 5010351 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACAGAAGTGTATTGAATGTTGGTAGG -3'
(R):5'- ACAGGACTTCAGGGGTTTCATTG -3'

Sequencing Primer
(F):5'- TGTATTGAATGTTGGTAGGAAGAAC -3'
(R):5'- CTTGCCAATGATGAAGACTTGGGC -3'
Posted On 2016-03-16