Mutagenetix > Incidental Mutations

Incidental Mutation 'R4850:Trp53bp1'

374527

Institutional Source

Beutler Lab

Gene Symbol

Trp53bp1

Ensembl Gene

ENSMUSG00000043909

Gene Name

transformation related protein 53 binding protein 1

Synonyms

53BP1, p53BP1

MMRRC Submission

042462-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4850 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121193281-121271407 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to A at 121205113 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000106278 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110647] [ENSMUST00000110648] [ENSMUST00000154426]

Predicted Effect

probably null
Transcript: ENSMUST00000110647

SMART Domains

Protein: ENSMUSP00000106277
Gene: ENSMUSG00000043909

Domain	Start	End	E-Value	Type
low complexity region	136	149	N/A	INTRINSIC
low complexity region	158	169	N/A	INTRINSIC
low complexity region	647	661	N/A	INTRINSIC
low complexity region	1031	1042	N/A	INTRINSIC
low complexity region	1099	1112	N/A	INTRINSIC
low complexity region	1260	1272	N/A	INTRINSIC
low complexity region	1290	1332	N/A	INTRINSIC
Pfam:53-BP1_Tudor	1430	1551	2.5e-80	PFAM
low complexity region	1581	1601	N/A	INTRINSIC
BRCT	1673	1785	7.13e-1	SMART
BRCT	1813	1901	1.03e-6	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000110648

SMART Domains

Protein: ENSMUSP00000106278
Gene: ENSMUSG00000043909

Domain	Start	End	E-Value	Type
low complexity region	136	149	N/A	INTRINSIC
low complexity region	158	169	N/A	INTRINSIC
low complexity region	647	661	N/A	INTRINSIC
low complexity region	1031	1042	N/A	INTRINSIC
low complexity region	1099	1112	N/A	INTRINSIC
low complexity region	1260	1272	N/A	INTRINSIC
low complexity region	1290	1332	N/A	INTRINSIC
low complexity region	1389	1409	N/A	INTRINSIC
Pfam:53-BP1_Tudor	1480	1601	1.5e-80	PFAM
low complexity region	1631	1651	N/A	INTRINSIC
BRCT	1723	1835	7.13e-1	SMART
BRCT	1863	1951	1.03e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124411

Predicted Effect

probably benign
Transcript: ENSMUST00000124554

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132812

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135890

Predicted Effect

probably benign
Transcript: ENSMUST00000147540

Predicted Effect

probably benign
Transcript: ENSMUST00000147540

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147554

Predicted Effect

probably benign
Transcript: ENSMUST00000154426

SMART Domains

Protein: ENSMUSP00000117548
Gene: ENSMUSG00000043909

Domain	Start	End	E-Value	Type
Pfam:53-BP1_Tudor	1	70	2.5e-44	PFAM
low complexity region	100	120	N/A	INTRINSIC

Meta Mutation Damage Score

0.9504

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

99% (79/80)

MGI Phenotype

PHENOTYPE: Homozygous mutations in this gene result in growth retardation, immunodeficiency, thymic hypoplasia, and increased incidence of thymic lymphomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,262,938	S3012P	unknown	Het
Abcb10	C	T	8: 123,982,690	A42T	probably benign	Het
Acsf3	T	C	8: 122,817,436	V551A	probably damaging	Het
Adgrl2	G	A	3: 148,859,020	T304I	probably damaging	Het
Akr1d1	A	G	6: 37,554,587		probably null	Het
Ankrd17	A	T	5: 90,264,786	H1226Q	probably damaging	Het
Arap1	T	C	7: 101,398,791	I847T	probably damaging	Het
Atad2b	G	A	12: 4,943,251	G257S	probably benign	Het
Cand2	A	T	6: 115,801,948	T1158S	probably benign	Het
Cic	G	A	7: 25,272,902	R686H	probably damaging	Het
Cldn1	T	A	16: 26,363,163	T99S	probably benign	Het
Cnga3	G	T	1: 37,258,006	E173*	probably null	Het
Cryge	G	T	1: 65,051,052		probably benign	Het
Dsp	T	A	13: 38,192,469	L1410H	probably damaging	Het
Dync2h1	T	C	9: 7,134,364	T1548A	probably benign	Het
Dysf	C	A	6: 84,097,715	D499E	probably damaging	Het
Eml5	T	C	12: 98,790,619	D1917G	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam71d	A	G	12: 78,715,153	D197G	probably damaging	Het
Fn3krp	A	T	11: 121,425,053	H90L	possibly damaging	Het
Gm10718	A	T	9: 3,023,716	T56S	probably benign	Het
Gm4847	A	T	1: 166,642,339	I55K	probably damaging	Het
Gsn	T	A	2: 35,283,900		probably null	Het
Haghl	T	C	17: 25,783,006		probably benign	Het
Hist1h2bj	G	T	13: 22,043,251		probably benign	Het
Hmg20b	T	A	10: 81,346,927	E139V	probably damaging	Het
Hsd3b6	G	A	3: 98,807,905	T57I	probably benign	Het
Igkv5-48	A	G	6: 69,726,796	S42P	probably damaging	Het
Igsf23	T	C	7: 19,953,934		probably benign	Het
Kcnt1	T	C	2: 25,908,100	F874L	probably damaging	Het
Maf1	T	C	15: 76,352,962	F110L	possibly damaging	Het
Mtpap	C	T	18: 4,387,044	R365W	probably damaging	Het
Mtus1	A	C	8: 41,084,470	S70A	possibly damaging	Het
Nfatc1	T	A	18: 80,697,865	T307S	probably benign	Het
Nphs1	T	G	7: 30,463,232	S379A	possibly damaging	Het
Nup205	A	G	6: 35,230,530	T1506A	probably benign	Het
Olfr1044	T	A	2: 86,171,671	I49F	probably damaging	Het
Olfr275	T	C	4: 52,825,450	S18P	possibly damaging	Het
Pcdhga8	A	T	18: 37,727,709	Y606F	probably damaging	Het
Pde7a	A	G	3: 19,243,117	V123A	probably benign	Het
Pex1	C	T	5: 3,624,426	T809I	probably benign	Het
Prdm13	C	A	4: 21,678,243	R749L	possibly damaging	Het
Prkcd	A	G	14: 30,599,743	L498P	probably damaging	Het
Pros1	A	T	16: 62,885,524	E67V	probably damaging	Het
Rab44	A	G	17: 29,140,089	E417G	possibly damaging	Het
Rangrf	A	G	11: 68,973,640		probably null	Het
Rp1	T	A	1: 4,348,675	K738M	probably damaging	Het
Ryr2	A	T	13: 11,668,820	D3119E	probably damaging	Het
Ryr2	G	A	13: 11,745,752	R1482C	probably damaging	Het
Sbspon	T	A	1: 15,858,968	T200S	probably damaging	Het
Sfxn5	T	C	6: 85,332,376		probably benign	Het
Slc26a8	T	A	17: 28,654,883	I377F	probably benign	Het
Slc30a7	A	G	3: 115,993,008	F72L	probably damaging	Het
Slc32a1	T	C	2: 158,614,192	F256L	possibly damaging	Het
Slco6b1	T	C	1: 96,911,833		noncoding transcript	Het
Smpd1	A	G	7: 105,555,985	H357R	probably benign	Het
Sncaip	A	T	18: 52,871,384	H361L	probably damaging	Het
Tenm2	A	C	11: 36,023,488	Y2406*	probably null	Het
Terb1	T	A	8: 104,485,425	H308L	probably benign	Het
Trim61	A	T	8: 65,013,418	L397H	probably damaging	Het
Ttn	T	G	2: 76,781,555	E9007D	possibly damaging	Het
Urb1	A	T	16: 90,795,414	C319*	probably null	Het
Vmn2r95	T	C	17: 18,451,653	Y551H	probably damaging	Het
Vwde	A	T	6: 13,196,048	V326D	possibly damaging	Het
Xdh	A	G	17: 73,898,335	L1045P	probably damaging	Het
Zfp638	T	C	6: 83,979,475	I1688T	possibly damaging	Het
Zwint	T	A	10: 72,655,956		probably benign	Het

Other mutations in Trp53bp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Trp53bp1	APN	2	121256579	missense	possibly damaging	0.69
IGL00690:Trp53bp1	APN	2	121235995	missense	probably damaging	1.00
IGL00922:Trp53bp1	APN	2	121208482	missense	probably damaging	0.96
IGL01475:Trp53bp1	APN	2	121270319	splice site	probably null
IGL01639:Trp53bp1	APN	2	121202692	missense	possibly damaging	0.51
IGL01662:Trp53bp1	APN	2	121236025	missense	probably damaging	1.00
IGL01757:Trp53bp1	APN	2	121211304	missense	probably damaging	0.99
IGL01829:Trp53bp1	APN	2	121215896	missense	probably benign	0.39
IGL02247:Trp53bp1	APN	2	121236589	missense	probably damaging	1.00
IGL02349:Trp53bp1	APN	2	121199074	missense	probably damaging	1.00
IGL02391:Trp53bp1	APN	2	121202710	missense	possibly damaging	0.67
chives	UTSW	2	121251868	missense	probably null	0.13
concur	UTSW	2	121270319	splice site	probably null
confirmation	UTSW	2	121205113	critical splice acceptor site	probably null
Infra	UTSW	2	121247499	critical splice donor site	probably null
lentil	UTSW	2	121251868	missense	probably null	0.13
lentil2	UTSW	2	121207887	missense	probably damaging	1.00
Profundus	UTSW	2	121207803	missense	probably damaging	1.00
split_pea	UTSW	2	121228606	nonsense	probably null
verily	UTSW	2	121211313	missense	probably damaging	1.00
PIT1430001:Trp53bp1	UTSW	2	121271275	missense	probably damaging	1.00
R0045:Trp53bp1	UTSW	2	121204497	missense	probably benign
R0060:Trp53bp1	UTSW	2	121204525	missense	probably damaging	1.00
R0060:Trp53bp1	UTSW	2	121204525	missense	probably damaging	1.00
R0103:Trp53bp1	UTSW	2	121236759	missense	possibly damaging	0.92
R0103:Trp53bp1	UTSW	2	121236759	missense	possibly damaging	0.92
R0281:Trp53bp1	UTSW	2	121270237	missense	probably damaging	1.00
R0386:Trp53bp1	UTSW	2	121204943	missense	probably damaging	1.00
R0427:Trp53bp1	UTSW	2	121236017	missense	probably damaging	1.00
R0505:Trp53bp1	UTSW	2	121269969	missense	probably damaging	0.99
R0522:Trp53bp1	UTSW	2	121251868	missense	probably null	0.13
R0523:Trp53bp1	UTSW	2	121251868	missense	probably null	0.13
R0525:Trp53bp1	UTSW	2	121251868	missense	probably null	0.13
R0543:Trp53bp1	UTSW	2	121251868	missense	probably null	0.13
R0559:Trp53bp1	UTSW	2	121227801	missense	probably damaging	1.00
R0573:Trp53bp1	UTSW	2	121228172	splice site	probably benign
R0593:Trp53bp1	UTSW	2	121270528	missense	possibly damaging	0.95
R0648:Trp53bp1	UTSW	2	121235707	missense	probably benign	0.20
R0680:Trp53bp1	UTSW	2	121251868	missense	probably null	0.13
R0732:Trp53bp1	UTSW	2	121248264	missense	probably null	0.96
R0905:Trp53bp1	UTSW	2	121204318	splice site	probably benign
R1377:Trp53bp1	UTSW	2	121270642	missense	probably damaging	1.00
R1415:Trp53bp1	UTSW	2	121236184	missense	probably damaging	1.00
R1725:Trp53bp1	UTSW	2	121252000	missense	possibly damaging	0.46
R1971:Trp53bp1	UTSW	2	121205036	missense	probably damaging	1.00
R2045:Trp53bp1	UTSW	2	121204483	missense	probably benign
R2143:Trp53bp1	UTSW	2	121216064	missense	probably benign	0.00
R2282:Trp53bp1	UTSW	2	121270273	nonsense	probably null
R2296:Trp53bp1	UTSW	2	121209247	missense	possibly damaging	0.96
R3106:Trp53bp1	UTSW	2	121236652	missense	probably damaging	1.00
R3792:Trp53bp1	UTSW	2	121200329	missense	probably damaging	1.00
R3793:Trp53bp1	UTSW	2	121200329	missense	probably damaging	1.00
R3946:Trp53bp1	UTSW	2	121228626	missense	probably damaging	0.99
R4001:Trp53bp1	UTSW	2	121205085	missense	probably damaging	1.00
R4327:Trp53bp1	UTSW	2	121256650	missense	probably damaging	1.00
R4585:Trp53bp1	UTSW	2	121207951	missense	probably damaging	1.00
R4630:Trp53bp1	UTSW	2	121207887	missense	probably damaging	1.00
R4744:Trp53bp1	UTSW	2	121211313	missense	probably damaging	1.00
R4751:Trp53bp1	UTSW	2	121227809	missense	probably damaging	1.00
R4754:Trp53bp1	UTSW	2	121207879	missense	probably damaging	1.00
R4755:Trp53bp1	UTSW	2	121228606	nonsense	probably null
R4870:Trp53bp1	UTSW	2	121256641	missense	probably damaging	1.00
R4879:Trp53bp1	UTSW	2	121202603	missense	probably damaging	0.99
R4924:Trp53bp1	UTSW	2	121221220	nonsense	probably null
R4962:Trp53bp1	UTSW	2	121270546	missense	probably benign	0.12
R5019:Trp53bp1	UTSW	2	121270319	splice site	probably null
R5111:Trp53bp1	UTSW	2	121211387	missense	probably damaging	0.99
R5149:Trp53bp1	UTSW	2	121216117	missense	probably benign	0.00
R5252:Trp53bp1	UTSW	2	121243983	missense	probably benign	0.40
R5533:Trp53bp1	UTSW	2	121207746	missense	probably damaging	1.00
R5642:Trp53bp1	UTSW	2	121236662	missense	probably benign	0.00
R5773:Trp53bp1	UTSW	2	121243914	missense	probably damaging	1.00
R5819:Trp53bp1	UTSW	2	121208392	nonsense	probably null
R5886:Trp53bp1	UTSW	2	121205021	missense	probably damaging	1.00
R5908:Trp53bp1	UTSW	2	121236823	missense	probably benign	0.06
R6012:Trp53bp1	UTSW	2	121256602	missense	probably benign	0.07
R6351:Trp53bp1	UTSW	2	121269945	missense	probably damaging	1.00
R6406:Trp53bp1	UTSW	2	121270612	missense	probably damaging	0.99
R6575:Trp53bp1	UTSW	2	121228603	missense	probably damaging	1.00
R6619:Trp53bp1	UTSW	2	121247499	critical splice donor site	probably null
R6626:Trp53bp1	UTSW	2	121207803	missense	probably damaging	1.00
R6754:Trp53bp1	UTSW	2	121270576	missense	possibly damaging	0.83
R6765:Trp53bp1	UTSW	2	121209309	missense	probably damaging	1.00
R6806:Trp53bp1	UTSW	2	121228666	missense	probably damaging	0.99
R6860:Trp53bp1	UTSW	2	121199113	missense	probably damaging	1.00
R6991:Trp53bp1	UTSW	2	121208040	missense	probably damaging	1.00
R7278:Trp53bp1	UTSW	2	121199035	missense	probably damaging	1.00
R7339:Trp53bp1	UTSW	2	121236469	missense	probably benign	0.00
R7357:Trp53bp1	UTSW	2	121211300	missense	probably damaging	1.00
R7477:Trp53bp1	UTSW	2	121236346	missense	probably benign	0.34
R7577:Trp53bp1	UTSW	2	121236638	missense	possibly damaging	0.65
R7728:Trp53bp1	UTSW	2	121207899	missense	probably damaging	1.00
R7806:Trp53bp1	UTSW	2	121205061	missense	probably damaging	0.99
RF046:Trp53bp1	UTSW	2	121216001	frame shift	probably null
Z1088:Trp53bp1	UTSW	2	121253645	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- CACAGGCAGTTGTTCAGGAAAG -3'
(R):5'- TGCTTTCTCTCAGAAGACCTTG -3'

Sequencing Primer
(F):5'- CAGGCAGTTGTTCAGGAAAGTCTTAC -3'
(R):5'- CAGAAGACCTTGTCTAATCCTAGTG -3'

Posted On

2016-03-16