Incidental Mutation 'R4853:Wdr27'
ID374537
Institutional Source Beutler Lab
Gene Symbol Wdr27
Ensembl Gene ENSMUSG00000046991
Gene NameWD repeat domain 27
Synonyms0610012K18Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R4853 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location14818519-14943158 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 14917213 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170386] [ENSMUST00000228330] [ENSMUST00000232147]
Predicted Effect probably null
Transcript: ENSMUST00000170386
SMART Domains Protein: ENSMUSP00000126736
Gene: ENSMUSG00000046991

DomainStartEndE-ValueType
WD40 59 99 4.79e-1 SMART
WD40 114 149 6.36e1 SMART
WD40 152 192 3.93e-7 SMART
WD40 195 235 2.38e1 SMART
low complexity region 473 492 N/A INTRINSIC
WD40 498 539 1.48e1 SMART
WD40 542 581 5.26e-8 SMART
WD40 642 684 2.97e0 SMART
WD40 687 737 7.64e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000228330
Predicted Effect probably benign
Transcript: ENSMUST00000232147
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple WD repeats. Proteins with these repeats may form scaffolds for protein-protein interaction and play key roles in cell signalling. Alternative splicing results in multiple transcript variants, but the full-length structure of some of these variants cannot be determined. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Abr T C 11: 76,464,261 T244A probably damaging Het
Adcy10 T A 1: 165,548,213 N803K probably benign Het
Afm T C 5: 90,551,467 F590S probably damaging Het
Agk T C 6: 40,383,819 probably null Het
Agrn C T 4: 156,185,550 probably null Het
AI481877 T C 4: 59,072,345 K624E possibly damaging Het
Apon A G 10: 128,255,082 S210G probably benign Het
Atad5 A G 11: 80,095,272 E395G probably damaging Het
AU018091 A T 7: 3,156,021 L671H probably damaging Het
Capn13 GCA G 17: 73,351,506 probably null Het
Ccdc154 A T 17: 25,170,967 I524F probably damaging Het
Clspn T A 4: 126,566,555 I525K probably damaging Het
Cpne5 A T 17: 29,161,198 V448E probably benign Het
Cps1 A G 1: 67,156,202 I261V possibly damaging Het
Crybb2 T C 5: 113,063,188 E78G probably damaging Het
Ctps G T 4: 120,554,010 L270I probably damaging Het
Cyp19a1 T C 9: 54,166,776 D431G probably benign Het
Cyp3a57 T G 5: 145,365,679 V95G probably damaging Het
Ddx54 A G 5: 120,623,629 D490G probably benign Het
Dnaic2 A T 11: 114,745,091 I301F probably benign Het
Dsg1b A G 18: 20,408,736 S767G probably benign Het
Dsg1b A T 18: 20,390,132 probably null Het
Ermap G A 4: 119,187,254 P115L probably damaging Het
Esrra T G 19: 6,920,072 T106P probably damaging Het
Exoc5 GTATT GT 14: 49,052,369 probably benign Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gnl3 T C 14: 31,015,313 K203E probably damaging Het
Habp2 G A 19: 56,311,191 probably null Het
Hist1h2ai A G 13: 21,716,696 E92G probably damaging Het
Kcnh3 A C 15: 99,242,089 D952A possibly damaging Het
Kif27 T C 13: 58,311,258 K920E probably benign Het
Kmt2e C T 5: 23,502,341 P1634L probably damaging Het
Lamc1 A T 1: 153,229,100 M1312K possibly damaging Het
Myh14 T A 7: 44,608,448 Q1921L probably damaging Het
Ncor2 A G 5: 125,025,105 V68A probably damaging Het
Ncor2 A G 5: 125,081,183 F444L unknown Het
Nedd9 A G 13: 41,316,361 Y439H probably benign Het
Nsd1 T A 13: 55,268,504 H1454Q probably benign Het
Olfr1160 A G 2: 88,006,104 S216P probably damaging Het
Olfr1418 T A 19: 11,855,281 D224V probably benign Het
Olfr152 T G 2: 87,783,182 F214C probably benign Het
Olfr624 G T 7: 103,670,803 T76K probably damaging Het
P4ha2 G A 11: 54,120,170 S337N probably benign Het
Pck1 T A 2: 173,154,714 Y140* probably null Het
Phldb2 T C 16: 45,802,716 M656V probably damaging Het
Pif1 T C 9: 65,593,576 W559R probably damaging Het
Pllp T C 8: 94,679,394 Y87C probably damaging Het
Ppp1r3a T C 6: 14,719,047 N623D probably benign Het
Prkcg C T 7: 3,318,953 R345C probably damaging Het
Rgl1 T C 1: 152,557,574 I147V probably benign Het
Sdk1 T A 5: 142,146,263 L1649Q probably damaging Het
Sema3b C T 9: 107,602,067 probably null Het
Sh3rf3 G A 10: 59,083,519 R486H probably damaging Het
Slain2 A G 5: 72,948,598 N192S probably benign Het
Slc22a16 T A 10: 40,574,051 I161N probably damaging Het
Strip1 T C 3: 107,616,916 K562E possibly damaging Het
Sumf1 A G 6: 108,185,495 L21S probably benign Het
Sytl3 T A 17: 6,737,765 S380T probably damaging Het
Tgfb1i1 T A 7: 128,248,668 C74* probably null Het
Tmprss15 T G 16: 78,960,591 I939L probably benign Het
Tpsb2 GGCTGCTGCTGCTGCTG GGCTGCTGCTGCTG 17: 25,366,562 probably benign Het
Vwde A T 6: 13,215,640 V139E probably damaging Het
Zkscan14 A G 5: 145,195,191 V510A probably benign Het
Other mutations in Wdr27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Wdr27 APN 17 14928310 nonsense probably null
IGL00973:Wdr27 APN 17 14913878 missense probably benign 0.01
IGL01012:Wdr27 APN 17 14926247 missense probably damaging 1.00
IGL01924:Wdr27 APN 17 14917226 missense probably damaging 0.99
IGL02044:Wdr27 APN 17 14901769 missense possibly damaging 0.72
IGL02198:Wdr27 APN 17 14908598 missense possibly damaging 0.52
IGL02430:Wdr27 APN 17 14901800 missense probably damaging 0.98
IGL02496:Wdr27 APN 17 14892431 splice site probably benign
IGL02552:Wdr27 APN 17 14926191 missense probably damaging 1.00
IGL02590:Wdr27 APN 17 14917779 missense possibly damaging 0.93
IGL02892:Wdr27 APN 17 14876176 missense possibly damaging 0.95
IGL02957:Wdr27 APN 17 14910110 splice site probably benign
IGL03295:Wdr27 APN 17 14934575 missense possibly damaging 0.71
PIT4498001:Wdr27 UTSW 17 14934569 missense probably benign 0.01
R0329:Wdr27 UTSW 17 14934459 splice site probably benign
R0671:Wdr27 UTSW 17 14928396 missense probably benign 0.04
R1166:Wdr27 UTSW 17 14892471 missense probably damaging 1.00
R1308:Wdr27 UTSW 17 14928384 missense probably damaging 0.98
R1652:Wdr27 UTSW 17 14917270 missense probably benign 0.01
R1771:Wdr27 UTSW 17 14892441 missense probably damaging 1.00
R1966:Wdr27 UTSW 17 14934599 missense possibly damaging 0.86
R2106:Wdr27 UTSW 17 14920854 missense probably benign 0.44
R2131:Wdr27 UTSW 17 14928332 missense probably damaging 1.00
R3803:Wdr27 UTSW 17 14918109 missense probably benign 0.01
R4335:Wdr27 UTSW 17 14920756 splice site probably null
R4577:Wdr27 UTSW 17 14903462 missense probably benign 0.00
R4787:Wdr27 UTSW 17 14932554 missense possibly damaging 0.86
R4922:Wdr27 UTSW 17 14920754 splice site probably null
R4951:Wdr27 UTSW 17 14876133 missense probably damaging 0.99
R5784:Wdr27 UTSW 17 14926233 missense probably damaging 1.00
R5809:Wdr27 UTSW 17 14883669 missense probably damaging 1.00
R6128:Wdr27 UTSW 17 14932534 nonsense probably null
R6584:Wdr27 UTSW 17 14901769 missense probably damaging 1.00
R6705:Wdr27 UTSW 17 14934590 missense probably damaging 1.00
R7511:Wdr27 UTSW 17 14883703 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGCAGTGTATTCCCTAACAAAG -3'
(R):5'- TGGGAAAGTCTCAACCACAC -3'

Sequencing Primer
(F):5'- GTGTATTCCCTAACAAAGGTAACGC -3'
(R):5'- TGGGAAAGTCTCAACCACACTAATG -3'
Posted On2016-03-16