Incidental Mutation 'R4856:Rpn2'
ID374549
Institutional Source Beutler Lab
Gene Symbol Rpn2
Ensembl Gene ENSMUSG00000027642
Gene Nameribophorin II
SynonymsRpn-2, 1300012C06Rik
MMRRC Submission 042467-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4856 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location157279017-157326319 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 157318044 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029171] [ENSMUST00000029171] [ENSMUST00000116380]
Predicted Effect probably null
Transcript: ENSMUST00000029171
SMART Domains Protein: ENSMUSP00000029171
Gene: ENSMUSG00000027642

DomainStartEndE-ValueType
Pfam:Ribophorin_II 2 71 1.5e-15 PFAM
Pfam:Ribophorin_II 68 596 3.5e-247 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000029171
SMART Domains Protein: ENSMUSP00000029171
Gene: ENSMUSG00000027642

DomainStartEndE-ValueType
Pfam:Ribophorin_II 2 71 1.5e-15 PFAM
Pfam:Ribophorin_II 68 596 3.5e-247 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000116380
SMART Domains Protein: ENSMUSP00000112081
Gene: ENSMUSG00000027642

DomainStartEndE-ValueType
Pfam:Ribophorin_II 9 627 1.8e-223 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123639
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149924
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I integral membrane protein found only in the rough endoplasmic reticulum. The encoded protein is part of an N-oligosaccharyl transferase complex that links high mannose oligosaccharides to asparagine residues found in the Asn-X-Ser/Thr consensus motif of nascent polypeptide chains. This protein is similar in sequence to the yeast oligosaccharyl transferase subunit SWP1. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp2 G A 6: 140,644,073 probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp2b4 T A 1: 133,706,780 I1177L probably benign Het
Bub3 A T 7: 131,561,568 D76V probably damaging Het
Cacna2d4 G A 6: 119,278,256 R578Q possibly damaging Het
Caprin2 A C 6: 148,873,011 S268A probably benign Het
Card6 T C 15: 5,105,141 probably null Het
Cdk13 A G 13: 17,719,734 S1103P probably benign Het
Cfap221 T C 1: 119,934,204 T614A probably damaging Het
Cfap221 T A 1: 119,984,758 Y133F probably damaging Het
Clcc1 A G 3: 108,676,838 T513A probably benign Het
Clec4g T A 8: 3,716,419 probably benign Het
Cntln A C 4: 84,971,229 E316D probably benign Het
Cpne2 T A 8: 94,563,964 D392E probably benign Het
Cry1 G T 10: 85,148,770 P147T probably damaging Het
Cyp4a29 T C 4: 115,252,881 V440A probably benign Het
Ddx46 A G 13: 55,638,199 D64G unknown Het
Dhx34 A G 7: 16,215,442 S354P possibly damaging Het
Ecm2 A T 13: 49,522,787 I327F possibly damaging Het
Elavl3 T C 9: 22,026,318 K189E possibly damaging Het
Enam A T 5: 88,488,734 R82* probably null Het
Erf A G 7: 25,246,211 V45A probably damaging Het
Fat3 T A 9: 16,021,330 I1436F probably benign Het
Flnc T C 6: 29,447,890 Y1231H probably damaging Het
Ggta1 T A 2: 35,402,791 H180L possibly damaging Het
Gm13103 G T 4: 143,853,303 R486L probably benign Het
Grin2c T C 11: 115,260,790 T115A probably damaging Het
H6pd C T 4: 149,982,778 V384M possibly damaging Het
Hba-x A G 11: 32,277,008 E39G probably benign Het
Hnrnpul2 C T 19: 8,829,827 P618S probably benign Het
Hpse2 C T 19: 42,788,957 R590H probably damaging Het
Ighv1-54 C A 12: 115,193,803 G75C probably damaging Het
Ighv8-11 C A 12: 115,567,154 R118L possibly damaging Het
Iqcm A T 8: 75,888,600 R436S possibly damaging Het
Islr T C 9: 58,157,606 D206G probably damaging Het
Itih1 A G 14: 30,936,701 probably null Het
Jam2 G A 16: 84,801,602 D34N probably benign Het
Klhl14 A T 18: 21,557,972 probably null Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Lrrc66 A G 5: 73,608,567 F378L probably benign Het
Map10 T A 8: 125,670,692 Y275N probably damaging Het
Mpi T C 9: 57,545,307 Y314C probably damaging Het
Mpp3 A G 11: 102,025,136 Y55H probably benign Het
Nectin4 T C 1: 171,384,815 V327A possibly damaging Het
Nlrp12 T A 7: 3,240,442 D480V probably damaging Het
Nolc1 GAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,083,155 probably benign Het
Notch2 A T 3: 98,102,419 Y554F probably damaging Het
Nrsn2 T C 2: 152,369,611 K167E probably benign Het
Olfr147 A T 9: 38,403,468 N195I probably damaging Het
Olfr1472 T C 19: 13,454,521 probably null Het
Olfr1501 T A 19: 13,838,279 E298V probably damaging Het
Olfr695 T A 7: 106,873,970 I92F probably damaging Het
Olfr761 A T 17: 37,952,071 S318T probably benign Het
Olr1 T A 6: 129,493,596 K203* probably null Het
Osbpl9 T C 4: 109,068,367 N485S probably benign Het
Pbk T A 14: 65,815,201 H164Q probably damaging Het
Pfn2 G T 3: 57,847,453 N10K probably damaging Het
Pik3ca A G 3: 32,437,163 D133G probably damaging Het
Prl6a1 A T 13: 27,319,000 D193V probably damaging Het
Rad21 G T 15: 51,968,500 P395Q probably damaging Het
Reps1 T A 10: 18,123,625 I720N probably damaging Het
Rreb1 G A 13: 37,931,058 V798M possibly damaging Het
Sardh C T 2: 27,244,477 R9H probably benign Het
Scgb3a2 C T 18: 43,766,754 P36S probably damaging Het
Scn10a C A 9: 119,694,309 G6V possibly damaging Het
Scn10a C T 9: 119,694,310 G6R possibly damaging Het
Scn3a T C 2: 65,461,032 D1790G probably damaging Het
Sec24b A T 3: 129,983,970 H1226Q probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc12a3 G A 8: 94,351,810 probably null Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Spata1 C G 3: 146,469,774 D326H probably damaging Het
Tcrg-V4 T C 13: 19,185,066 V29A probably benign Het
Tex52 A T 6: 128,384,988 probably null Het
Tma16 A C 8: 66,481,477 C75W probably damaging Het
Tmem67 G A 4: 12,089,416 probably benign Het
Trmt10a A T 3: 138,148,385 K75* probably null Het
Ttc3 T C 16: 94,390,283 V228A probably benign Het
Ttn T C 2: 76,731,300 D28954G probably damaging Het
Uggt2 A G 14: 119,035,964 probably null Het
Vars T A 17: 35,015,726 V1177E probably benign Het
Vmn1r59 T C 7: 5,454,533 D76G possibly damaging Het
Vmn2r114 G T 17: 23,308,034 A508E probably benign Het
Vps41 G A 13: 18,829,255 V348M probably damaging Het
Zbtb43 T C 2: 33,453,932 H427R probably damaging Het
Other mutations in Rpn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Rpn2 APN 2 157314913 missense probably damaging 1.00
IGL01894:Rpn2 APN 2 157294173 missense probably benign 0.45
IGL02104:Rpn2 APN 2 157321827 missense probably damaging 1.00
IGL02368:Rpn2 APN 2 157302408 missense probably benign
IGL02819:Rpn2 APN 2 157316210 critical splice donor site probably null
R0932:Rpn2 UTSW 2 157283771 missense possibly damaging 0.66
R1666:Rpn2 UTSW 2 157294155 missense possibly damaging 0.93
R1668:Rpn2 UTSW 2 157294155 missense possibly damaging 0.93
R1713:Rpn2 UTSW 2 157314968 missense probably damaging 0.99
R2276:Rpn2 UTSW 2 157310288 missense possibly damaging 0.64
R2279:Rpn2 UTSW 2 157310288 missense possibly damaging 0.64
R3409:Rpn2 UTSW 2 157290652 missense possibly damaging 0.91
R3411:Rpn2 UTSW 2 157290652 missense possibly damaging 0.91
R3777:Rpn2 UTSW 2 157299557 missense probably damaging 0.99
R4004:Rpn2 UTSW 2 157318008 missense probably damaging 1.00
R4575:Rpn2 UTSW 2 157295324 missense probably damaging 1.00
R4613:Rpn2 UTSW 2 157302425 missense possibly damaging 0.87
R4886:Rpn2 UTSW 2 157318044 critical splice donor site probably null
R5491:Rpn2 UTSW 2 157297383 missense probably damaging 0.99
R5526:Rpn2 UTSW 2 157323267 missense probably damaging 1.00
R5633:Rpn2 UTSW 2 157283596 missense possibly damaging 0.81
R5718:Rpn2 UTSW 2 157321827 missense probably damaging 1.00
R5772:Rpn2 UTSW 2 157295345 missense probably damaging 1.00
R6101:Rpn2 UTSW 2 157310188 splice site probably null
R6618:Rpn2 UTSW 2 157321861 missense probably benign
R6698:Rpn2 UTSW 2 157297410 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TCAAAGCCTTGGCCTCTAGG -3'
(R):5'- TGGCAGCAATTTTCTCATGTG -3'

Sequencing Primer
(F):5'- AGGTATTTCCTCTCCTCAGTTGTTGG -3'
(R):5'- AATGGATGCATTTATTTGGCTCTTCC -3'
Posted On2016-03-16