Incidental Mutation 'R4824:Mcph1'
ID374565
Institutional Source Beutler Lab
Gene Symbol Mcph1
Ensembl Gene ENSMUSG00000039842
Gene Namemicrocephaly, primary autosomal recessive 1
SynonymsBRIT1, D030046N04Rik, 5430437K10Rik
MMRRC Submission 042440-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4824 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location18595131-18803189 bp(+) (GRCm38)
Type of Mutationintron (44 bp from exon)
DNA Base Change (assembly) T to A at 18632687 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039412] [ENSMUST00000124910] [ENSMUST00000133417] [ENSMUST00000141244] [ENSMUST00000141244] [ENSMUST00000146819]
Predicted Effect probably null
Transcript: ENSMUST00000039412
SMART Domains Protein: ENSMUSP00000037000
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
BRCT 13 89 2.64e-4 SMART
coiled coil region 128 155 N/A INTRINSIC
Pfam:Microcephalin 224 597 1.2e-143 PFAM
BRCT 624 707 2.23e-2 SMART
BRCT 740 810 1.55e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124910
SMART Domains Protein: ENSMUSP00000131698
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
BRCT 13 89 2.64e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000133417
SMART Domains Protein: ENSMUSP00000121636
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
coiled coil region 14 41 N/A INTRINSIC
Pfam:Microcephalin 136 256 2.4e-51 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000141244
SMART Domains Protein: ENSMUSP00000119267
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
Blast:BRCT 2 38 2e-9 BLAST
low complexity region 39 51 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000141244
SMART Domains Protein: ENSMUSP00000119267
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
Blast:BRCT 2 38 2e-9 BLAST
low complexity region 39 51 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146819
SMART Domains Protein: ENSMUSP00000131616
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
BRCT 13 89 2.64e-4 SMART
coiled coil region 128 155 N/A INTRINSIC
Pfam:Microcephalin 224 598 1.4e-168 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153133
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 98% (123/126)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA damage response protein. The encoded protein may play a role in G2/M checkpoint arrest via maintenance of inhibitory phosphorylation of cyclin-dependent kinase 1. Mutations in this gene have been associated with primary autosomal recessive microcephaly 1 and premature chromosome condensation syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous null mice are born at a reduced rate and display male and female infertility and arrest of male meiosis. Mice homozygous for another knock-out allele exhibit microcephaly, infertility, decreased brain size, impaired neuroprogenitor proliferation and apoptosis, and mitosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,676 T209A probably benign Het
1700086D15Rik T C 11: 65,152,615 probably benign Het
4930452B06Rik A T 14: 8,665,997 M1K probably null Het
A130010J15Rik G A 1: 193,174,657 V106I probably benign Het
Abca16 C A 7: 120,475,479 N580K possibly damaging Het
Actrt2 A T 4: 154,666,887 F264Y probably damaging Het
Adh4 G A 3: 138,429,046 S327N possibly damaging Het
Alkbh5 T C 11: 60,553,871 probably null Het
Anapc1 T A 2: 128,628,690 T1507S possibly damaging Het
Anapc2 A G 2: 25,277,752 R444G probably damaging Het
Apoh G T 11: 108,414,261 W335L probably benign Het
B4galt7 A T 13: 55,604,349 H71L possibly damaging Het
Bicd2 A G 13: 49,379,012 E358G probably damaging Het
Bmper T A 9: 23,223,660 V7D possibly damaging Het
Brca2 T C 5: 150,539,735 F988S probably damaging Het
Brix1 A G 15: 10,485,742 V49A possibly damaging Het
Brpf3 T C 17: 28,806,486 S178P probably benign Het
Btaf1 A G 19: 36,981,048 Y655C possibly damaging Het
C1rl C G 6: 124,509,081 Y470* probably null Het
Cacnb4 A G 2: 52,675,810 V21A probably benign Het
Caskin1 C A 17: 24,501,129 P437T probably benign Het
Casz1 C A 4: 148,944,571 P1158T probably damaging Het
Ccdc141 T A 2: 77,124,336 Q189L probably damaging Het
Ccr3 T C 9: 124,028,772 V48A probably damaging Het
Cebpd G A 16: 15,888,114 G264S probably benign Het
Chd1 C A 17: 15,733,124 S440R probably damaging Het
Clip1 T A 5: 123,631,023 E504D probably damaging Het
Cmya5 T C 13: 93,093,574 R1669G probably benign Het
Col11a2 T A 17: 34,050,963 F456I probably damaging Het
Col4a3bp C T 13: 96,616,487 P350S probably benign Het
Ctnna2 A T 6: 76,980,781 M130K probably damaging Het
Elmo2 A T 2: 165,292,002 probably benign Het
F11 T C 8: 45,255,342 D27G probably damaging Het
Faap100 A T 11: 120,375,586 probably null Het
Fat1 A G 8: 44,989,114 E1151G probably damaging Het
Fbll1 T A 11: 35,797,825 I204F probably damaging Het
Gle1 T A 2: 29,940,203 V257D possibly damaging Het
Hoxc9 T A 15: 102,981,793 C47* probably null Het
Hsd17b6 A G 10: 127,993,655 V226A probably benign Het
Hsd17b7 C T 1: 169,961,195 R151Q probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ido2 A G 8: 24,533,859 I321T probably benign Het
Irf2bp2 T C 8: 126,591,433 T465A probably benign Het
Kdm2a A G 19: 4,362,787 M34T probably damaging Het
Klhl6 C T 16: 19,957,028 R260H probably damaging Het
Kntc1 T A 5: 123,790,133 L1231* probably null Het
Lca5l A C 16: 96,162,029 Y412* probably null Het
Lipt1 T C 1: 37,875,432 S190P possibly damaging Het
Ly6f T A 15: 75,271,720 V92D probably damaging Het
Matn4 T A 2: 164,393,231 M433L probably benign Het
Mbtd1 C A 11: 93,925,702 P370T probably benign Het
Muc5b T A 7: 141,864,185 C3623S probably damaging Het
Myt1l C A 12: 29,849,400 H134N probably benign Het
Nav2 A T 7: 49,409,001 probably benign Het
Ndufaf8 T C 11: 120,099,166 C35R probably damaging Het
Neb G A 2: 52,204,879 T5130I possibly damaging Het
Nlrp9c T C 7: 26,380,564 N624S possibly damaging Het
Nr0b2 C A 4: 133,556,023 H190Q probably damaging Het
Nrg4 A G 9: 55,249,121 probably benign Het
Nup88 A T 11: 70,961,624 V215E probably benign Het
Oas2 T G 5: 120,738,346 T511P probably benign Het
Olfr1151 T C 2: 87,857,277 V34A probably benign Het
Olfr1162 A C 2: 88,050,088 F179V probably damaging Het
Olfr1500 A C 19: 13,828,354 L14R probably damaging Het
Olfr384 A G 11: 73,602,600 T7A possibly damaging Het
Olfr720 A G 14: 14,175,885 S66P probably damaging Het
Olfr943 A G 9: 39,184,205 N9S probably benign Het
Pcdhgb2 T A 18: 37,690,449 N164K probably damaging Het
Pde4d C G 13: 109,116,866 P76A probably benign Het
Phlda1 T C 10: 111,507,655 probably benign Het
Plekhh1 A G 12: 79,054,803 T216A probably benign Het
Plppr3 T A 10: 79,865,673 E445V possibly damaging Het
Prom1 A G 5: 44,034,390 V337A probably damaging Het
Prr14l T C 5: 32,844,399 probably benign Het
Psmd1 A G 1: 86,137,098 I951V probably benign Het
Rab35 T G 5: 115,643,395 I85M possibly damaging Het
Rad9a A T 19: 4,200,537 S93T probably benign Het
Ric1 G A 19: 29,585,842 C555Y probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror2 T A 13: 53,110,683 Q791L probably benign Het
Rps8 G C 4: 117,155,155 probably benign Het
Sdr16c5 C T 4: 4,016,216 W70* probably null Het
Senp3 A G 11: 69,677,995 V408A probably benign Het
Sh2d4b C A 14: 40,840,344 W288L probably benign Het
Slc38a9 A T 13: 112,723,298 D422V probably damaging Het
Slc4a2 T C 5: 24,440,143 F1104L probably damaging Het
Slc4a3 A G 1: 75,550,623 K113E possibly damaging Het
Spata3 G A 1: 86,024,326 probably null Het
Spata31d1d A T 13: 59,729,241 V160E possibly damaging Het
Sprr2f A G 3: 92,365,896 M1V probably null Het
Sptbn1 A G 11: 30,118,295 V1733A possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tardbp A G 4: 148,617,593 I295T probably benign Het
Tmem212 A G 3: 27,885,008 S110P probably damaging Het
Tnc G A 4: 64,017,620 Q360* probably null Het
Tnrc6c C A 11: 117,722,905 Q630K probably damaging Het
Ttc19 G A 11: 62,309,096 R235H probably benign Het
Ube3b T A 5: 114,415,726 probably null Het
Vmn2r31 C T 7: 7,387,063 probably null Het
Vmn2r92 T A 17: 18,151,921 probably benign Het
Washc5 A T 15: 59,333,636 Y685* probably null Het
Wdr93 T A 7: 79,750,069 Y135* probably null Het
Wdr95 T A 5: 149,595,332 I546K probably damaging Het
Zbtb38 T A 9: 96,688,201 T277S probably benign Het
Zfp13 T C 17: 23,576,823 D258G possibly damaging Het
Zfp397 T A 18: 23,960,192 S245T probably benign Het
Zfp646 T C 7: 127,883,735 Y1695H probably benign Het
Other mutations in Mcph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Mcph1 APN 8 18632620 missense possibly damaging 0.95
IGL00816:Mcph1 APN 8 18632397 missense possibly damaging 0.59
IGL01432:Mcph1 APN 8 18625639 missense probably damaging 0.99
IGL01674:Mcph1 APN 8 18631519 missense probably damaging 1.00
IGL01746:Mcph1 APN 8 18671127 missense probably damaging 1.00
IGL01788:Mcph1 APN 8 18632403 missense probably damaging 1.00
IGL01788:Mcph1 APN 8 18632404 missense probably damaging 1.00
IGL02185:Mcph1 APN 8 18668990 splice site probably benign
IGL02677:Mcph1 APN 8 18625593 missense probably damaging 1.00
IGL03376:Mcph1 APN 8 18596973 missense probably damaging 0.99
PIT4514001:Mcph1 UTSW 8 18631890 missense probably damaging 0.99
R0116:Mcph1 UTSW 8 18788248 missense probably benign 0.06
R0189:Mcph1 UTSW 8 18788471 missense probably damaging 0.96
R1510:Mcph1 UTSW 8 18632687 intron probably null
R1547:Mcph1 UTSW 8 18622686 missense possibly damaging 0.65
R1574:Mcph1 UTSW 8 18801412 missense probably damaging 0.99
R1574:Mcph1 UTSW 8 18801412 missense probably damaging 0.99
R1733:Mcph1 UTSW 8 18631963 missense probably benign 0.18
R1742:Mcph1 UTSW 8 18607363 missense probably benign 0.03
R1975:Mcph1 UTSW 8 18689065 splice site probably benign
R3836:Mcph1 UTSW 8 18622659 missense possibly damaging 0.91
R4405:Mcph1 UTSW 8 18632541 missense probably benign 0.00
R4493:Mcph1 UTSW 8 18631736 nonsense probably null
R4873:Mcph1 UTSW 8 18625558 critical splice acceptor site probably null
R4875:Mcph1 UTSW 8 18625558 critical splice acceptor site probably null
R5125:Mcph1 UTSW 8 18607326 missense probably damaging 0.98
R5178:Mcph1 UTSW 8 18607326 missense probably damaging 0.98
R5217:Mcph1 UTSW 8 18788473 missense probably damaging 0.99
R5233:Mcph1 UTSW 8 18671238 missense probably damaging 0.96
R5299:Mcph1 UTSW 8 18652580 intron probably benign
R5335:Mcph1 UTSW 8 18689061 critical splice donor site probably null
R5579:Mcph1 UTSW 8 18632293 missense probably benign 0.18
R5621:Mcph1 UTSW 8 18632170 missense probably damaging 1.00
R5655:Mcph1 UTSW 8 18788310 missense probably benign 0.02
R5721:Mcph1 UTSW 8 18671207 missense probably damaging 0.99
R6076:Mcph1 UTSW 8 18631999 missense probably benign 0.40
R6592:Mcph1 UTSW 8 18668967 missense probably damaging 0.97
R7269:Mcph1 UTSW 8 18607272 splice site probably null
R7446:Mcph1 UTSW 8 18671093 missense probably benign 0.00
R7455:Mcph1 UTSW 8 18631759 missense probably benign 0.26
R7542:Mcph1 UTSW 8 18631689 missense probably benign 0.03
R7640:Mcph1 UTSW 8 18632326 missense probably benign 0.00
R7703:Mcph1 UTSW 8 18671106 missense possibly damaging 0.82
RF002:Mcph1 UTSW 8 18652529 small insertion probably benign
RF035:Mcph1 UTSW 8 18652525 small insertion probably benign
RF059:Mcph1 UTSW 8 18652525 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AACCAGAGACCCAGGTGATG -3'
(R):5'- TCCACTAGGACAAAGCCTGG -3'

Sequencing Primer
(F):5'- TGATGGAAAAGGCTCCCCC -3'
(R):5'- ACAAAGCCTGGGGAGGTATTTTC -3'
Posted On2016-03-16