Incidental Mutation 'R4861:Nr5a2'
ID374569
Institutional Source Beutler Lab
Gene Symbol Nr5a2
Ensembl Gene ENSMUSG00000026398
Gene Namenuclear receptor subfamily 5, group A, member 2
SynonymsD1Ertd308e, Ftf, LRH-1, UF2-H3B
MMRRC Submission 042472-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4861 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location136842571-136960448 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 136948720 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027649] [ENSMUST00000168126] [ENSMUST00000192357] [ENSMUST00000192929] [ENSMUST00000195428]
Predicted Effect probably null
Transcript: ENSMUST00000027649
SMART Domains Protein: ENSMUSP00000027649
Gene: ENSMUSG00000026398

DomainStartEndE-ValueType
ZnF_C4 104 175 2.85e-40 SMART
Blast:HOLI 196 247 1e-5 BLAST
low complexity region 290 302 N/A INTRINSIC
HOLI 366 529 4.13e-46 SMART
Predicted Effect probably null
Transcript: ENSMUST00000168126
SMART Domains Protein: ENSMUSP00000129071
Gene: ENSMUSG00000026398

DomainStartEndE-ValueType
ZnF_C4 43 114 2.85e-40 SMART
low complexity region 229 241 N/A INTRINSIC
HOLI 305 468 4.13e-46 SMART
Predicted Effect probably null
Transcript: ENSMUST00000192357
SMART Domains Protein: ENSMUSP00000142219
Gene: ENSMUSG00000026398

DomainStartEndE-ValueType
ZnF_C4 83 154 1.1e-42 SMART
Blast:HOLI 175 226 1e-5 BLAST
low complexity region 269 281 N/A INTRINSIC
HOLI 345 508 1.7e-48 SMART
Predicted Effect probably null
Transcript: ENSMUST00000192929
SMART Domains Protein: ENSMUSP00000141495
Gene: ENSMUSG00000026398

DomainStartEndE-ValueType
ZnF_C4 43 114 2.85e-40 SMART
low complexity region 229 241 N/A INTRINSIC
HOLI 305 468 4.13e-46 SMART
Predicted Effect probably null
Transcript: ENSMUST00000195428
SMART Domains Protein: ENSMUSP00000141645
Gene: ENSMUSG00000026398

DomainStartEndE-ValueType
ZnF_C4 43 114 1.1e-42 SMART
Meta Mutation Damage Score 0.9505 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA-binding zinc finger transcription factor and is a member of the fushi tarazu factor-1 subfamily of orphan nuclear receptors. The encoded protein is involved in the expression of genes for hepatitis B virus and cholesterol biosynthesis, and may be an important regulator of embryonic development. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene die around embryonic day 7.5. Heterozygotes are essentially normal but with lower plasma cholesterol, increased bile acids, and shorter intestinal crypt length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,245,905 R1153H probably damaging Het
Ahcy T C 2: 155,060,516 E411G probably benign Het
Alpi T A 1: 87,100,469 I211F probably damaging Het
Arfgef3 G A 10: 18,607,731 A1415V probably benign Het
Bora T C 14: 99,047,474 probably null Het
Car3 T C 3: 14,866,896 V109A probably damaging Het
Ccdc114 A G 7: 45,942,873 E359G probably damaging Het
Cdk13 A T 13: 17,766,586 V17D probably damaging Het
Cept1 A C 3: 106,505,732 S226A probably damaging Het
Dbt A T 3: 116,548,078 I443L probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Farp2 T C 1: 93,605,419 L633S probably damaging Het
Gm26727 T C 2: 67,432,945 I79M probably damaging Het
Gm5800 T A 14: 51,716,047 N37I probably damaging Het
Hapln1 G A 13: 89,601,452 G39S possibly damaging Het
Ice2 T A 9: 69,415,448 S408R probably benign Het
Lctl T C 9: 64,119,763 I131T possibly damaging Het
Ncoa7 T A 10: 30,704,612 M117L probably benign Het
Npy4r C T 14: 34,146,883 W149* probably null Het
Plg G A 17: 12,395,735 E301K probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Rapgef2 T C 3: 79,074,436 K1084R probably benign Het
Slc41a2 T C 10: 83,316,458 Q51R probably damaging Het
Slc47a2 A T 11: 61,336,233 C170S probably benign Het
Slco1b2 A T 6: 141,671,222 N427I possibly damaging Het
Smc2 G A 4: 52,461,090 R571H probably benign Het
Sp4 G T 12: 118,300,811 probably null Het
Tas2r117 T C 6: 132,803,129 F77L probably benign Het
Tbcd C T 11: 121,601,961 R875C probably damaging Het
Thumpd2 A G 17: 81,026,801 S453P probably benign Het
Vars2 G T 17: 35,661,933 Q13K probably benign Het
Other mutations in Nr5a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Nr5a2 APN 1 136890798 missense probably damaging 1.00
IGL01082:Nr5a2 APN 1 136845468 missense probably benign 0.06
IGL02547:Nr5a2 APN 1 136940927 missense probably benign 0.01
IGL02688:Nr5a2 APN 1 136940407 critical splice donor site probably null
IGL02712:Nr5a2 APN 1 136940528 splice site probably null
aggressivity UTSW 1 136882344 missense possibly damaging 0.78
R0356:Nr5a2 UTSW 1 136845692 missense possibly damaging 0.91
R0653:Nr5a2 UTSW 1 136948805 missense probably benign 0.04
R1111:Nr5a2 UTSW 1 136882421 splice site probably null
R1728:Nr5a2 UTSW 1 136952125 missense probably benign
R1729:Nr5a2 UTSW 1 136952125 missense probably benign
R1730:Nr5a2 UTSW 1 136952125 missense probably benign
R1739:Nr5a2 UTSW 1 136952125 missense probably benign
R1762:Nr5a2 UTSW 1 136952125 missense probably benign
R1783:Nr5a2 UTSW 1 136952125 missense probably benign
R1784:Nr5a2 UTSW 1 136952125 missense probably benign
R1785:Nr5a2 UTSW 1 136952125 missense probably benign
R1927:Nr5a2 UTSW 1 136944994 missense probably damaging 1.00
R2360:Nr5a2 UTSW 1 136948827 missense probably benign
R3408:Nr5a2 UTSW 1 136940498 missense probably benign
R4662:Nr5a2 UTSW 1 136940429 missense probably benign 0.00
R4861:Nr5a2 UTSW 1 136948720 critical splice donor site probably null
R5176:Nr5a2 UTSW 1 136948802 start codon destroyed probably null 0.96
R5999:Nr5a2 UTSW 1 136845542 missense probably damaging 1.00
R6191:Nr5a2 UTSW 1 136890798 missense probably damaging 1.00
R6457:Nr5a2 UTSW 1 136960238 missense probably benign 0.00
R6747:Nr5a2 UTSW 1 136882344 missense possibly damaging 0.78
R8170:Nr5a2 UTSW 1 136940647 missense probably benign 0.06
X0012:Nr5a2 UTSW 1 136943292 missense probably damaging 1.00
X0065:Nr5a2 UTSW 1 136940777 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGTGGCCAATTAGACGTTGATG -3'
(R):5'- CTTTCCGCTGGAGTTGAATCTC -3'

Sequencing Primer
(F):5'- GCCTAGTTCAAGTGCCATTAAC -3'
(R):5'- GGAGTTGAATCTCTGCTGCCC -3'
Posted On2016-03-16