Incidental Mutation 'R4837:Olfr449'
ID374574
Institutional Source Beutler Lab
Gene Symbol Olfr449
Ensembl Gene ENSMUSG00000049168
Gene Nameolfactory receptor 449
SynonymsGA_x6K02T2P3E9-4722003-4721068, MOR103-1
MMRRC Submission 042452-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R4837 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location42834384-42839516 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to G at 42837849 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000059233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050729] [ENSMUST00000050729] [ENSMUST00000050729] [ENSMUST00000204072] [ENSMUST00000204229] [ENSMUST00000214687]
Predicted Effect probably null
Transcript: ENSMUST00000050729
SMART Domains Protein: ENSMUSP00000059233
Gene: ENSMUSG00000049168

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 2.7e-52 PFAM
Pfam:7tm_1 41 288 2e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000050729
SMART Domains Protein: ENSMUSP00000059233
Gene: ENSMUSG00000049168

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 2.7e-52 PFAM
Pfam:7tm_1 41 288 2e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000050729
SMART Domains Protein: ENSMUSP00000059233
Gene: ENSMUSG00000049168

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 2.7e-52 PFAM
Pfam:7tm_1 41 288 2e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203135
SMART Domains Protein: ENSMUSP00000144965
Gene: ENSMUSG00000049168

DomainStartEndE-ValueType
Pfam:7tm_4 31 193 2.1e-32 PFAM
Pfam:7tm_1 41 193 7.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204072
Predicted Effect probably benign
Transcript: ENSMUST00000204229
SMART Domains Protein: ENSMUSP00000145055
Gene: ENSMUSG00000049168

DomainStartEndE-ValueType
Pfam:7tm_4 31 130 1.7e-20 PFAM
Pfam:7tm_1 41 130 2.6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214687
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,246,980 H618L probably benign Het
Adgrl3 A G 5: 81,766,234 T1230A probably benign Het
Ahnak2 A G 12: 112,785,739 S203P probably benign Het
Allc A G 12: 28,559,309 V244A probably benign Het
Ap3m1 G A 14: 21,037,157 P157L probably damaging Het
Arhgef2 T G 3: 88,632,943 I97S probably damaging Het
Btaf1 C A 19: 36,966,785 T398K probably benign Het
Cabp1 T C 5: 115,173,153 M158V probably damaging Het
Ccdc162 G A 10: 41,673,867 P340L probably benign Het
Clip4 A G 17: 71,834,222 K524E probably damaging Het
Cltc A G 11: 86,695,648 V189A probably benign Het
Cmc2 A G 8: 116,894,140 F34S probably damaging Het
Ctcfl G T 2: 173,113,656 T271N probably benign Het
Cyp4f16 T A 17: 32,542,764 F124I possibly damaging Het
Ddx41 C A 13: 55,531,648 R479L possibly damaging Het
Dgcr6 C A 16: 18,066,846 N87K possibly damaging Het
Dll1 A G 17: 15,368,859 L518P probably damaging Het
Dnaja4 G T 9: 54,710,644 M263I probably benign Het
Dusp13 T A 14: 21,743,525 probably benign Het
Fam185a T A 5: 21,480,377 I357N probably benign Het
Fam186a T C 15: 99,940,797 Y2522C unknown Het
Fam222a T A 5: 114,594,397 C4* probably null Het
Filip1 T C 9: 79,819,459 D626G probably damaging Het
Ghrhr C T 6: 55,388,187 R389C probably damaging Het
Gm8251 G A 1: 44,061,434 T168I possibly damaging Het
Gstm3 T A 3: 107,964,215 T217S probably benign Het
Gucy2g T C 19: 55,226,053 T548A probably benign Het
Hectd3 T A 4: 117,002,597 C744S probably null Het
Hnrnpl T C 7: 28,817,337 S184P probably benign Het
Il3 G A 11: 54,267,257 probably benign Het
Itga5 C T 15: 103,354,084 G330S probably damaging Het
Kl A G 5: 150,980,847 T355A possibly damaging Het
Lipk A C 19: 34,032,320 S208R probably damaging Het
Mrs2 T A 13: 24,999,057 probably null Het
Mutyh A G 4: 116,817,690 E372G probably damaging Het
Myh4 C A 11: 67,258,992 A1821D probably benign Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nlrp12 T C 7: 3,231,061 E881G probably damaging Het
Nol9 T C 4: 152,052,095 probably benign Het
Nwd1 A G 8: 72,657,131 E52G probably damaging Het
Olfr1025-ps1 A G 2: 85,918,404 T160A probably benign Het
Olfr1294 T A 2: 111,537,974 H105L probably damaging Het
Olfr1415 A G 1: 92,490,975 V260A probably benign Het
Olfr1508 A T 14: 52,463,646 M121K probably damaging Het
Opn4 A G 14: 34,596,304 V242A probably damaging Het
Paxbp1 G A 16: 91,034,978 Q341* probably null Het
Pcdh7 T C 5: 57,720,411 V436A possibly damaging Het
Pcdhb18 G A 18: 37,489,814 V66M probably damaging Het
Pikfyve A G 1: 65,246,590 E951G possibly damaging Het
Plcg1 A G 2: 160,750,986 N179S probably benign Het
Prr11 A C 11: 87,098,691 S285A probably benign Het
Ranbp17 A G 11: 33,328,451 S139P probably damaging Het
Rasa4 G A 5: 136,091,810 probably null Het
Rnf213 G C 11: 119,442,763 G2934R probably benign Het
Rpap1 A G 2: 119,778,251 V210A probably benign Het
Rpn1 T A 6: 88,090,205 N182K probably benign Het
Rps24 C T 14: 24,491,787 T14I possibly damaging Het
Rrp12 C T 19: 41,877,505 probably null Het
Rttn T A 18: 89,090,415 probably null Het
Rufy1 A G 11: 50,401,493 S490P probably damaging Het
Sec62 T A 3: 30,809,869 M100K unknown Het
Spata16 A G 3: 26,732,932 H253R possibly damaging Het
Srcap T C 7: 127,558,962 probably benign Het
Srrm1 A G 4: 135,345,512 probably benign Het
Tbcd G A 11: 121,582,785 probably null Het
Tedc2 C A 17: 24,220,593 A25S probably damaging Het
Tnr A T 1: 159,684,788 probably benign Het
Tnxb A C 17: 34,718,007 D3730A probably damaging Het
Tor2a G A 2: 32,760,597 G201D probably damaging Het
Tpp1 T C 7: 105,746,649 T558A probably benign Het
Vmn1r211 G T 13: 22,852,126 Q124K probably benign Het
Wasf3 T C 5: 146,460,978 V185A probably benign Het
Zbtb12 A G 17: 34,896,009 T257A probably benign Het
Other mutations in Olfr449
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01904:Olfr449 APN 6 42838289 missense possibly damaging 0.76
IGL02193:Olfr449 APN 6 42838819 utr 3 prime probably benign
IGL02496:Olfr449 APN 6 42838804 missense probably benign 0.00
IGL03302:Olfr449 APN 6 42838003 nonsense probably null
IGL03333:Olfr449 APN 6 42838703 missense possibly damaging 0.95
R1340:Olfr449 UTSW 6 42838009 missense probably benign 0.00
R1926:Olfr449 UTSW 6 42838313 missense probably damaging 1.00
R2418:Olfr449 UTSW 6 42838049 missense probably benign 0.03
R5466:Olfr449 UTSW 6 42838093 missense probably benign 0.08
R5733:Olfr449 UTSW 6 42838246 missense probably damaging 0.97
R6411:Olfr449 UTSW 6 42838720 missense possibly damaging 0.57
R6626:Olfr449 UTSW 6 42838648 missense probably benign 0.14
R6912:Olfr449 UTSW 6 42838802 missense probably benign
R7278:Olfr449 UTSW 6 42834396 utr 5 prime probably null
R7399:Olfr449 UTSW 6 42838746 nonsense probably null
R7703:Olfr449 UTSW 6 42838004 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCCATGCATCGATCTAAC -3'
(R):5'- GATGATGATCACGTTTTCAGCTAC -3'

Sequencing Primer
(F):5'- TGCATCGATCTAACCCAGTGAGTC -3'
(R):5'- GATCACGTTTTCAGCTACAGTCAG -3'
Posted On2016-03-16