Incidental Mutation 'R4837:Rttn'
ID374577
Institutional Source Beutler Lab
Gene Symbol Rttn
Ensembl Gene ENSMUSG00000023066
Gene Namerotatin
SynonymsC530033I08Rik, 4921538A15Rik
MMRRC Submission 042452-MU
Accession Numbers

Ncbi RefSeq: NM_175542.3; MGI:2179288

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4837 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location88971790-89131013 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 89090415 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023828] [ENSMUST00000023828] [ENSMUST00000023828] [ENSMUST00000023828]
Predicted Effect probably null
Transcript: ENSMUST00000023828
SMART Domains Protein: ENSMUSP00000023828
Gene: ENSMUSG00000023066

DomainStartEndE-ValueType
Pfam:RTTN_N 16 112 1.2e-36 PFAM
low complexity region 188 199 N/A INTRINSIC
Blast:ARM 216 261 9e-18 BLAST
low complexity region 302 319 N/A INTRINSIC
low complexity region 335 341 N/A INTRINSIC
SCOP:d1gw5a_ 515 952 9e-3 SMART
Blast:ARM 863 910 4e-8 BLAST
low complexity region 972 985 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1213 1222 N/A INTRINSIC
low complexity region 1680 1698 N/A INTRINSIC
low complexity region 1861 1879 N/A INTRINSIC
Blast:ARM 2088 2129 1e-10 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000023828
SMART Domains Protein: ENSMUSP00000023828
Gene: ENSMUSG00000023066

DomainStartEndE-ValueType
Pfam:RTTN_N 16 112 1.2e-36 PFAM
low complexity region 188 199 N/A INTRINSIC
Blast:ARM 216 261 9e-18 BLAST
low complexity region 302 319 N/A INTRINSIC
low complexity region 335 341 N/A INTRINSIC
SCOP:d1gw5a_ 515 952 9e-3 SMART
Blast:ARM 863 910 4e-8 BLAST
low complexity region 972 985 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1213 1222 N/A INTRINSIC
low complexity region 1680 1698 N/A INTRINSIC
low complexity region 1861 1879 N/A INTRINSIC
Blast:ARM 2088 2129 1e-10 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000023828
SMART Domains Protein: ENSMUSP00000023828
Gene: ENSMUSG00000023066

DomainStartEndE-ValueType
Pfam:RTTN_N 16 112 1.2e-36 PFAM
low complexity region 188 199 N/A INTRINSIC
Blast:ARM 216 261 9e-18 BLAST
low complexity region 302 319 N/A INTRINSIC
low complexity region 335 341 N/A INTRINSIC
SCOP:d1gw5a_ 515 952 9e-3 SMART
Blast:ARM 863 910 4e-8 BLAST
low complexity region 972 985 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1213 1222 N/A INTRINSIC
low complexity region 1680 1698 N/A INTRINSIC
low complexity region 1861 1879 N/A INTRINSIC
Blast:ARM 2088 2129 1e-10 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000023828
SMART Domains Protein: ENSMUSP00000023828
Gene: ENSMUSG00000023066

DomainStartEndE-ValueType
Pfam:RTTN_N 16 112 1.2e-36 PFAM
low complexity region 188 199 N/A INTRINSIC
Blast:ARM 216 261 9e-18 BLAST
low complexity region 302 319 N/A INTRINSIC
low complexity region 335 341 N/A INTRINSIC
SCOP:d1gw5a_ 515 952 9e-3 SMART
Blast:ARM 863 910 4e-8 BLAST
low complexity region 972 985 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1213 1222 N/A INTRINSIC
low complexity region 1680 1698 N/A INTRINSIC
low complexity region 1861 1879 N/A INTRINSIC
Blast:ARM 2088 2129 1e-10 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (75/76)
MGI Phenotype Strain: 2674124
Lethality: E9-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein whose specific function is unknown. Absence of the orthologous protein in mouse results in embryonic lethality with deficient axial rotation, abnormal differentiation of the neural tube, and randomized looping of the heart tube during development. In human, mutations in this gene are associated with polymicrogyria with seizures. In human fibroblasts this protein localizes at the ciliary basal bodies. Given the intracellular localization of this protein and the phenotypic effects of mutations, this gene is suspected of playing a role in the maintenance of normal ciliary structure which in turn effects the developmental process of left-right organ specification, axial rotation, and perhaps notochord development. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for an insertional mutation exhibit embryonic lethality and neurulation defects resulting in the arrest of gastrulation movements and abnormal left-right specification in the heart. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted(2) Gene trapped(12) Transgenic(1)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,246,980 H618L probably benign Het
Adgrl3 A G 5: 81,766,234 T1230A probably benign Het
Ahnak2 A G 12: 112,785,739 S203P probably benign Het
Allc A G 12: 28,559,309 V244A probably benign Het
Ap3m1 G A 14: 21,037,157 P157L probably damaging Het
Arhgef2 T G 3: 88,632,943 I97S probably damaging Het
Btaf1 C A 19: 36,966,785 T398K probably benign Het
Cabp1 T C 5: 115,173,153 M158V probably damaging Het
Ccdc162 G A 10: 41,673,867 P340L probably benign Het
Clip4 A G 17: 71,834,222 K524E probably damaging Het
Cltc A G 11: 86,695,648 V189A probably benign Het
Cmc2 A G 8: 116,894,140 F34S probably damaging Het
Ctcfl G T 2: 173,113,656 T271N probably benign Het
Cyp4f16 T A 17: 32,542,764 F124I possibly damaging Het
Ddx41 C A 13: 55,531,648 R479L possibly damaging Het
Dgcr6 C A 16: 18,066,846 N87K possibly damaging Het
Dll1 A G 17: 15,368,859 L518P probably damaging Het
Dnaja4 G T 9: 54,710,644 M263I probably benign Het
Dusp13 T A 14: 21,743,525 probably benign Het
Fam185a T A 5: 21,480,377 I357N probably benign Het
Fam186a T C 15: 99,940,797 Y2522C unknown Het
Fam222a T A 5: 114,594,397 C4* probably null Het
Filip1 T C 9: 79,819,459 D626G probably damaging Het
Ghrhr C T 6: 55,388,187 R389C probably damaging Het
Gm8251 G A 1: 44,061,434 T168I possibly damaging Het
Gstm3 T A 3: 107,964,215 T217S probably benign Het
Gucy2g T C 19: 55,226,053 T548A probably benign Het
Hectd3 T A 4: 117,002,597 C744S probably null Het
Hnrnpl T C 7: 28,817,337 S184P probably benign Het
Il3 G A 11: 54,267,257 probably benign Het
Itga5 C T 15: 103,354,084 G330S probably damaging Het
Kl A G 5: 150,980,847 T355A possibly damaging Het
Lipk A C 19: 34,032,320 S208R probably damaging Het
Mrs2 T A 13: 24,999,057 probably null Het
Mutyh A G 4: 116,817,690 E372G probably damaging Het
Myh4 C A 11: 67,258,992 A1821D probably benign Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nlrp12 T C 7: 3,231,061 E881G probably damaging Het
Nol9 T C 4: 152,052,095 probably benign Het
Nwd1 A G 8: 72,657,131 E52G probably damaging Het
Olfr1025-ps1 A G 2: 85,918,404 T160A probably benign Het
Olfr1294 T A 2: 111,537,974 H105L probably damaging Het
Olfr1415 A G 1: 92,490,975 V260A probably benign Het
Olfr1508 A T 14: 52,463,646 M121K probably damaging Het
Olfr449 T G 6: 42,837,849 probably null Het
Opn4 A G 14: 34,596,304 V242A probably damaging Het
Paxbp1 G A 16: 91,034,978 Q341* probably null Het
Pcdh7 T C 5: 57,720,411 V436A possibly damaging Het
Pcdhb18 G A 18: 37,489,814 V66M probably damaging Het
Pikfyve A G 1: 65,246,590 E951G possibly damaging Het
Plcg1 A G 2: 160,750,986 N179S probably benign Het
Prr11 A C 11: 87,098,691 S285A probably benign Het
Ranbp17 A G 11: 33,328,451 S139P probably damaging Het
Rasa4 G A 5: 136,091,810 probably null Het
Rnf213 G C 11: 119,442,763 G2934R probably benign Het
Rpap1 A G 2: 119,778,251 V210A probably benign Het
Rpn1 T A 6: 88,090,205 N182K probably benign Het
Rps24 C T 14: 24,491,787 T14I possibly damaging Het
Rrp12 C T 19: 41,877,505 probably null Het
Rufy1 A G 11: 50,401,493 S490P probably damaging Het
Sec62 T A 3: 30,809,869 M100K unknown Het
Spata16 A G 3: 26,732,932 H253R possibly damaging Het
Srcap T C 7: 127,558,962 probably benign Het
Srrm1 A G 4: 135,345,512 probably benign Het
Tbcd G A 11: 121,582,785 probably null Het
Tedc2 C A 17: 24,220,593 A25S probably damaging Het
Tnr A T 1: 159,684,788 probably benign Het
Tnxb A C 17: 34,718,007 D3730A probably damaging Het
Tor2a G A 2: 32,760,597 G201D probably damaging Het
Tpp1 T C 7: 105,746,649 T558A probably benign Het
Vmn1r211 G T 13: 22,852,126 Q124K probably benign Het
Wasf3 T C 5: 146,460,978 V185A probably benign Het
Zbtb12 A G 17: 34,896,009 T257A probably benign Het
Other mutations in Rttn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Rttn APN 18 88974340 missense probably benign 0.00
IGL00788:Rttn APN 18 88972509 missense probably benign 0.00
IGL00929:Rttn APN 18 89028935 missense probably damaging 1.00
IGL01392:Rttn APN 18 88995613 missense probably benign 0.03
IGL01395:Rttn APN 18 89129770 missense possibly damaging 0.89
IGL01701:Rttn APN 18 89064215 missense probably damaging 1.00
IGL02136:Rttn APN 18 89046128 missense possibly damaging 0.87
IGL02151:Rttn APN 18 89020205 missense probably damaging 1.00
IGL02165:Rttn APN 18 89043041 missense probably benign
IGL02228:Rttn APN 18 89042231 missense probably damaging 1.00
IGL02276:Rttn APN 18 89048454 missense possibly damaging 0.94
IGL02612:Rttn APN 18 88973626 missense probably damaging 1.00
IGL02645:Rttn APN 18 89110686 missense probably benign 0.04
IGL02716:Rttn APN 18 89048417 missense possibly damaging 0.77
IGL02820:Rttn APN 18 89028998 missense probably damaging 1.00
IGL02961:Rttn APN 18 89053573 missense probably damaging 1.00
IGL02973:Rttn APN 18 88972494 missense probably damaging 1.00
IGL03027:Rttn APN 18 88979690 missense probably damaging 1.00
IGL03082:Rttn APN 18 88983948 missense probably damaging 1.00
IGL03121:Rttn APN 18 88975751 missense probably damaging 1.00
IGL03135:Rttn APN 18 89015150 missense probably damaging 1.00
IGL03328:Rttn APN 18 89043028 missense probably benign 0.19
R0062:Rttn UTSW 18 89010966 critical splice donor site probably null
R0062:Rttn UTSW 18 89010966 critical splice donor site probably null
R0310:Rttn UTSW 18 89009460 splice site probably benign
R0330:Rttn UTSW 18 88986080 splice site probably null
R0363:Rttn UTSW 18 89010955 missense probably damaging 1.00
R0485:Rttn UTSW 18 89090419 splice site probably benign
R0590:Rttn UTSW 18 88979635 missense probably damaging 1.00
R0601:Rttn UTSW 18 89042966 missense probably benign 0.00
R0604:Rttn UTSW 18 88977758 missense probably damaging 1.00
R0631:Rttn UTSW 18 88989546 missense probably benign 0.00
R0882:Rttn UTSW 18 88973689 nonsense probably null
R0885:Rttn UTSW 18 88983810 missense probably benign 0.03
R0900:Rttn UTSW 18 89101691 missense probably benign 0.13
R1077:Rttn UTSW 18 89064249 missense probably damaging 1.00
R1444:Rttn UTSW 18 89042867 missense probably benign 0.04
R1460:Rttn UTSW 18 89109357 splice site probably benign
R1517:Rttn UTSW 18 89113350 missense probably benign 0.01
R1630:Rttn UTSW 18 89042954 missense probably benign 0.02
R1632:Rttn UTSW 18 89009336 missense probably benign 0.18
R1722:Rttn UTSW 18 88973531 missense probably benign 0.34
R1755:Rttn UTSW 18 89009317 missense probably damaging 1.00
R1881:Rttn UTSW 18 89015212 missense probably damaging 0.96
R1971:Rttn UTSW 18 89090433 missense probably benign
R2035:Rttn UTSW 18 89020216 missense probably damaging 1.00
R2109:Rttn UTSW 18 88986073 missense possibly damaging 0.93
R2191:Rttn UTSW 18 89095648 critical splice donor site probably null
R2201:Rttn UTSW 18 89010943 missense possibly damaging 0.88
R2266:Rttn UTSW 18 89064171 missense probably benign 0.05
R3014:Rttn UTSW 18 89014620 missense probably damaging 1.00
R3052:Rttn UTSW 18 89015246 splice site probably benign
R3427:Rttn UTSW 18 89095651 splice site probably null
R3431:Rttn UTSW 18 89095571 missense probably benign 0.04
R3786:Rttn UTSW 18 89037894 missense probably benign 0.00
R3803:Rttn UTSW 18 88977707 missense probably damaging 0.96
R3980:Rttn UTSW 18 89017275 missense probably benign 0.12
R4035:Rttn UTSW 18 88995653 missense probably benign 0.03
R4170:Rttn UTSW 18 88975723 missense probably damaging 1.00
R4223:Rttn UTSW 18 89095584 missense probably damaging 1.00
R4273:Rttn UTSW 18 89091896 missense probably benign
R4517:Rttn UTSW 18 89028973 missense probably damaging 0.99
R4674:Rttn UTSW 18 89011011 intron probably null
R4869:Rttn UTSW 18 89043014 nonsense probably null
R4881:Rttn UTSW 18 89101685 missense probably damaging 1.00
R4959:Rttn UTSW 18 89042168 missense probably damaging 1.00
R4973:Rttn UTSW 18 89042168 missense probably damaging 1.00
R4975:Rttn UTSW 18 89064085 intron probably null
R5166:Rttn UTSW 18 89013094 missense possibly damaging 0.48
R5243:Rttn UTSW 18 89108063 missense possibly damaging 0.74
R5594:Rttn UTSW 18 89090436 missense possibly damaging 0.95
R5654:Rttn UTSW 18 89048432 missense probably benign
R5794:Rttn UTSW 18 88995569 missense probably benign 0.18
R5799:Rttn UTSW 18 89037946 missense probably damaging 0.99
R5955:Rttn UTSW 18 89121009 missense probably damaging 0.99
R5963:Rttn UTSW 18 89073695 missense probably benign 0.01
R5989:Rttn UTSW 18 88973626 missense probably damaging 1.00
R6004:Rttn UTSW 18 89021692 missense probably damaging 0.96
R6132:Rttn UTSW 18 89115646 critical splice donor site probably null
R6430:Rttn UTSW 18 89021685 missense probably null 0.18
R6436:Rttn UTSW 18 89110729 missense probably damaging 1.00
R6681:Rttn UTSW 18 89014611 missense probably damaging 1.00
R6994:Rttn UTSW 18 89028899 missense probably damaging 1.00
R7049:Rttn UTSW 18 89064216 missense probably damaging 1.00
R7078:Rttn UTSW 18 89009422 missense probably benign 0.03
R7083:Rttn UTSW 18 89090598 missense probably damaging 1.00
R7250:Rttn UTSW 18 88989523 missense probably benign 0.03
R7402:Rttn UTSW 18 88985911 missense possibly damaging 0.92
R7565:Rttn UTSW 18 89060479 missense probably damaging 1.00
R7588:Rttn UTSW 18 89064229 missense probably damaging 0.97
X0017:Rttn UTSW 18 89113402 missense probably benign 0.01
X0022:Rttn UTSW 18 88973667 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCACATGTACACGCACAG -3'
(R):5'- CAGAGGAGTTCTATGAGATGAGCTTG -3'

Sequencing Primer
(F):5'- AGTGAGGGATGGGGGTTC -3'
(R):5'- GTTGAAAAGCATTTGCAGCATCTC -3'
Posted On2016-03-16