Incidental Mutation 'R4862:Gm8251'
ID374579
Institutional Source Beutler Lab
Gene Symbol Gm8251
Ensembl Gene ENSMUSG00000091844
Gene Namepredicted gene 8251
Synonyms
MMRRC Submission 043260-MU
Accession Numbers

Genbank: XM_985572; MGI: 3647616

Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R4862 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location44055952-44061936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44058018 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 1307 (P1307S)
Ref Sequence ENSEMBL: ENSMUSP00000127017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168641]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168641
AA Change: P1307S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127017
Gene: ENSMUSG00000091844
AA Change: P1307S

DomainStartEndE-ValueType
Pfam:CCDC168_N 2 202 2.5e-83 PFAM
Pfam:CCDC168_N 200 302 1.7e-26 PFAM
Pfam:CCDC168_N 347 397 2.1e-4 PFAM
Pfam:CCDC168_N 437 581 8.5e-8 PFAM
Pfam:CCDC168_N 663 802 6.3e-5 PFAM
Pfam:CCDC168_N 788 955 1e-9 PFAM
low complexity region 1803 1819 N/A INTRINSIC
low complexity region 1830 1847 N/A INTRINSIC
low complexity region 1968 1984 N/A INTRINSIC
Meta Mutation Damage Score 0.1038 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T G 6: 41,032,411 D163A possibly damaging Het
5330417C22Rik A G 3: 108,467,833 S573P probably benign Het
Acox3 A G 5: 35,589,739 T167A probably benign Het
Aox1 T G 1: 58,095,157 D1096E probably damaging Het
Arid4a A T 12: 71,075,947 D1034V probably damaging Het
Chaf1b T A 16: 93,887,134 L91Q probably damaging Het
Copb2 G T 9: 98,581,267 D512Y probably damaging Het
Daam1 A G 12: 71,942,207 E127G unknown Het
Dhx16 A G 17: 35,883,262 I422V probably benign Het
Dnah6 C T 6: 73,121,788 V2043I probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync2h1 A G 9: 7,147,717 V971A probably benign Het
Elmo1 A G 13: 20,449,512 H448R probably benign Het
Fndc1 A T 17: 7,769,735 V1165D unknown Het
Hapln1 G A 13: 89,601,452 G39S possibly damaging Het
Igkv6-13 C A 6: 70,457,781 V27L probably benign Het
Krt28 A T 11: 99,365,110 I441N possibly damaging Het
Lgr5 A T 10: 115,462,764 D286E probably damaging Het
Mapkap1 A G 2: 34,623,430 Y448C probably damaging Het
Olfr1094 T A 2: 86,829,532 V260E probably damaging Het
Olfr453 T C 6: 42,744,555 Y173H possibly damaging Het
Ppt1 A C 4: 122,844,449 N89T probably damaging Het
Ptgs1 G T 2: 36,237,255 R51L probably damaging Het
Slc47a2 A G 11: 61,313,694 F277S possibly damaging Het
Smcr8 A G 11: 60,778,071 E15G probably benign Het
Tbce A G 13: 13,998,419 S476P possibly damaging Het
Tmem131l A T 3: 83,898,210 probably benign Het
Unc5c T C 3: 141,789,773 Y468H probably damaging Het
Ush1c A T 7: 46,229,240 L117H probably damaging Het
Wdfy4 A G 14: 33,100,903 probably null Het
Zfa-ps G T 10: 52,543,096 noncoding transcript Het
Zfat C A 15: 68,180,110 A605S probably benign Het
Zfp853 T A 5: 143,289,661 Q68L unknown Het
Zfyve16 G A 13: 92,508,256 T1146I probably damaging Het
Other mutations in Gm8251
AlleleSourceChrCoordTypePredicted EffectPPH Score
D3080:Gm8251 UTSW 1 44067335
R0045:Gm8251 UTSW 1 44057205 missense probably benign
R0110:Gm8251 UTSW 1 44059224 missense probably benign
R0450:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0469:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0510:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0602:Gm8251 UTSW 1 44059967 missense possibly damaging 0.96
R0648:Gm8251 UTSW 1 44056563 missense possibly damaging 0.73
R0928:Gm8251 UTSW 1 44057228 missense possibly damaging 0.73
R1056:Gm8251 UTSW 1 44060927 missense probably damaging 1.00
R1217:Gm8251 UTSW 1 44057179 missense possibly damaging 0.73
R1232:Gm8251 UTSW 1 44056592 missense possibly damaging 0.96
R1399:Gm8251 UTSW 1 44061311 missense possibly damaging 0.93
R1489:Gm8251 UTSW 1 44057790 missense probably benign 0.18
R1489:Gm8251 UTSW 1 44061507 missense probably benign 0.06
R1519:Gm8251 UTSW 1 44056970 missense probably benign 0.33
R1664:Gm8251 UTSW 1 44059227 missense possibly damaging 0.71
R1828:Gm8251 UTSW 1 44057074 missense possibly damaging 0.72
R1944:Gm8251 UTSW 1 44061849 missense probably damaging 0.97
R2032:Gm8251 UTSW 1 44061740 missense possibly damaging 0.86
R2094:Gm8251 UTSW 1 44059730 missense probably benign 0.06
R2170:Gm8251 UTSW 1 44056008 missense probably benign 0.18
R2185:Gm8251 UTSW 1 44061381 missense probably benign 0.01
R2280:Gm8251 UTSW 1 44056460 missense possibly damaging 0.53
R2281:Gm8251 UTSW 1 44056460 missense possibly damaging 0.53
R2339:Gm8251 UTSW 1 44060863 missense probably benign
R3617:Gm8251 UTSW 1 44060954 missense probably benign
R3738:Gm8251 UTSW 1 44058866 missense probably benign 0.33
R4012:Gm8251 UTSW 1 44060969 missense possibly damaging 0.85
R4034:Gm8251 UTSW 1 44058866 missense probably benign 0.33
R4344:Gm8251 UTSW 1 44060991 missense possibly damaging 0.86
R4436:Gm8251 UTSW 1 44056116 missense probably benign 0.03
R4485:Gm8251 UTSW 1 44060123 missense probably benign
R4735:Gm8251 UTSW 1 44061701 missense probably benign
R4782:Gm8251 UTSW 1 44059043 missense possibly damaging 0.85
R4837:Gm8251 UTSW 1 44061434 missense possibly damaging 0.93
R5247:Gm8251 UTSW 1 44057006 nonsense probably null
R5347:Gm8251 UTSW 1 44057795 missense probably benign 0.01
R5355:Gm8251 UTSW 1 44057979 missense possibly damaging 0.53
R5559:Gm8251 UTSW 1 44058515 missense possibly damaging 0.77
R5640:Gm8251 UTSW 1 44061927 missense probably benign 0.00
R5681:Gm8251 UTSW 1 44061464 missense possibly damaging 0.93
R5776:Gm8251 UTSW 1 44056505 missense possibly damaging 0.72
R5919:Gm8251 UTSW 1 44056986 missense probably benign
R5987:Gm8251 UTSW 1 44057257 missense probably benign
R6616:Gm8251 UTSW 1 44061474 missense possibly damaging 0.51
R6677:Gm8251 UTSW 1 44058699 missense probably benign 0.00
R6830:Gm8251 UTSW 1 44056730 missense probably benign 0.33
R6906:Gm8251 UTSW 1 44056013 missense probably benign 0.33
R6909:Gm8251 UTSW 1 44059775 missense possibly damaging 0.71
R6957:Gm8251 UTSW 1 44057207 missense probably benign 0.00
R7008:Gm8251 UTSW 1 44059625 missense probably benign
R7052:Gm8251 UTSW 1 44057306 missense possibly damaging 0.53
R7176:Gm8251 UTSW 1 44060346 missense probably benign 0.00
R7190:Gm8251 UTSW 1 44061615 missense probably benign 0.32
R7296:Gm8251 UTSW 1 44060916 nonsense probably null
R7347:Gm8251 UTSW 1 44059496 missense probably damaging 0.99
R7371:Gm8251 UTSW 1 44061377 missense probably benign
R7375:Gm8251 UTSW 1 44060534 missense possibly damaging 0.53
R7442:Gm8251 UTSW 1 44058708 missense possibly damaging 0.84
R7450:Gm8251 UTSW 1 44058773 missense probably benign 0.33
R7574:Gm8251 UTSW 1 44059433 missense possibly damaging 0.93
R7586:Gm8251 UTSW 1 44060013 missense probably benign 0.20
R7739:Gm8251 UTSW 1 44056418 missense possibly damaging 0.86
R7878:Gm8251 UTSW 1 44056014 missense probably benign 0.18
R7959:Gm8251 UTSW 1 44057568 missense probably benign
R7991:Gm8251 UTSW 1 44059709 missense probably benign 0.00
R8035:Gm8251 UTSW 1 44061551 missense possibly damaging 0.51
R8281:Gm8251 UTSW 1 44056538 missense possibly damaging 0.93
YA93:Gm8251 UTSW 1 44065085 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCGAGAGTCACGGTTCTGTAAG -3'
(R):5'- ATTTGACACTGGGGAAGCTGC -3'

Sequencing Primer
(F):5'- CTGTAAGGATGTGTTCACCATGTC -3'
(R):5'- GGAACTGTGCACATATTTCCTG -3'
Posted On2016-03-17