Incidental Mutation 'R0280:Polb'
ID37459
Institutional Source Beutler Lab
Gene Symbol Polb
Ensembl Gene ENSMUSG00000031536
Gene Namepolymerase (DNA directed), beta
SynonymsPol beta, A430088C08Rik
MMRRC Submission 038502-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0280 (G1)
Quality Score186
Status Validated
Chromosome8
Chromosomal Location22628126-22653435 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22640392 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 173 (Y173N)
Ref Sequence ENSEMBL: ENSMUSP00000033938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033938] [ENSMUST00000210950]
Predicted Effect probably damaging
Transcript: ENSMUST00000033938
AA Change: Y173N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033938
Gene: ENSMUSG00000031536
AA Change: Y173N

DomainStartEndE-ValueType
POLXc 10 334 4.58e-159 SMART
HhH1 57 76 1.91e-1 SMART
HhH1 98 117 1.14e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181668
Predicted Effect probably benign
Transcript: ENSMUST00000210950
Meta Mutation Damage Score 0.4141 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA polymerase involved in base excision and repair, also called gap-filling DNA synthesis. The encoded protein, acting as a monomer, is normally found in the cytoplasm, but it translocates to the nucleus upon DNA damage. Several transcript variants of this gene exist, but the full-length nature of only one has been described to date. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for one knock-out allele die from E10.5 to birth and those for another one exhibit embryonic growth retardation, abnormal neurogenesis, and neonatal lethality due to respiratory failure. Hypomorphic allele mice develop systemic lupus erythematosus-like phentoypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Adam18 C T 8: 24,674,054 G38R probably benign Het
Ankrd16 T G 2: 11,781,501 V187G probably damaging Het
AU019823 T C 9: 50,609,379 T123A probably damaging Het
Ccdc110 A T 8: 45,943,450 N793Y probably benign Het
Ccdc170 T C 10: 4,558,663 I629T possibly damaging Het
Clcn6 A G 4: 148,008,715 L836P probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crocc T C 4: 141,028,426 E1097G probably damaging Het
Csmd1 A T 8: 16,271,602 V494E probably damaging Het
Drg1 A T 11: 3,256,537 probably null Het
Dscam T C 16: 97,039,006 K134E possibly damaging Het
Dyrk1b T C 7: 28,184,312 Y198H probably damaging Het
Esr1 A G 10: 4,856,951 D289G probably benign Het
Esr1 G T 10: 4,939,289 V396F probably damaging Het
Evi5l T C 8: 4,193,133 V339A probably damaging Het
Fat4 A T 3: 38,890,816 Q1286L probably benign Het
Frem1 T C 4: 82,969,444 H1118R probably damaging Het
Fuk A T 8: 110,894,748 V188D probably damaging Het
Fut9 C T 4: 25,619,852 D321N probably benign Het
Gaa T G 11: 119,284,547 V917G probably damaging Het
Gm973 GCC GC 1: 59,544,680 probably null Het
Kidins220 A G 12: 25,010,141 T767A probably damaging Het
Kif7 A G 7: 79,698,823 S1257P probably benign Het
Ltn1 A G 16: 87,397,838 L1391P probably damaging Het
Mast3 A G 8: 70,783,795 Y681H probably damaging Het
Mast3 A G 8: 70,787,920 V291A possibly damaging Het
Metrn C T 17: 25,795,135 R239H probably benign Het
Mphosph10 C A 7: 64,376,703 K666N possibly damaging Het
Mtbp C T 15: 55,586,461 T433I probably benign Het
Mtmr2 A G 9: 13,799,249 K365E probably damaging Het
Nanog A G 6: 122,713,398 D229G probably damaging Het
Npepps T C 11: 97,241,014 N338S possibly damaging Het
Nphp4 T A 4: 152,551,936 probably benign Het
Olfr1279 T C 2: 111,307,072 F289S possibly damaging Het
Plcl2 A G 17: 50,607,034 E357G probably damaging Het
R3hdm1 T A 1: 128,162,775 S74T probably benign Het
Raet1d T A 10: 22,370,883 C37S probably damaging Het
Reln G A 5: 22,227,513 probably benign Het
Rps6kc1 T C 1: 190,809,000 S369G probably damaging Het
Sgf29 A G 7: 126,671,571 E108G probably benign Het
Sh3tc1 A G 5: 35,706,017 L942P probably damaging Het
Slc22a27 A T 19: 7,896,822 L188* probably null Het
Slc9a3 T A 13: 74,159,424 I445N probably damaging Het
Sufu A T 19: 46,450,673 probably benign Het
Tomm40 G A 7: 19,713,751 T118I probably damaging Het
Ttc25 A T 11: 100,550,265 K107N probably damaging Het
Ttn C T 2: 76,740,479 R26690H probably damaging Het
Vmn2r16 A G 5: 109,340,139 I293V possibly damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Vsig8 A G 1: 172,561,538 D119G probably benign Het
Other mutations in Polb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Polb APN 8 22653072 missense probably damaging 1.00
IGL02421:Polb APN 8 22640373 missense probably damaging 1.00
IGL02618:Polb APN 8 22637093 missense probably damaging 1.00
IGL02850:Polb APN 8 22648261 splice site probably benign
IGL03143:Polb APN 8 22640351 splice site probably benign
IGL02796:Polb UTSW 8 22631458 missense probably damaging 1.00
R0383:Polb UTSW 8 22639995 nonsense probably null
R0788:Polb UTSW 8 22642338 missense probably null
R1374:Polb UTSW 8 22653057 splice site probably benign
R1564:Polb UTSW 8 22630341 critical splice donor site probably null
R2194:Polb UTSW 8 22647467 missense probably benign 0.05
R2295:Polb UTSW 8 22653319 missense probably damaging 1.00
R2314:Polb UTSW 8 22640002 missense possibly damaging 0.69
R4992:Polb UTSW 8 22645071 missense probably damaging 0.97
R5107:Polb UTSW 8 22645046 splice site probably null
R5474:Polb UTSW 8 22630370 missense probably benign 0.13
R5905:Polb UTSW 8 22639995 nonsense probably null
R5908:Polb UTSW 8 22642303 critical splice donor site probably null
R6028:Polb UTSW 8 22639995 nonsense probably null
R6188:Polb UTSW 8 22647447 missense probably damaging 0.99
R7304:Polb UTSW 8 22639959 missense probably benign
R7644:Polb UTSW 8 22640427 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACTCAGGTGCAATGACAGAGACAAC -3'
(R):5'- AGCACATCAGAGCCTTCTTCCGTG -3'

Sequencing Primer
(F):5'- TGGGATAAACATGCCCAAGC -3'
(R):5'- CCAGGTGCTTTGATCTATAAACC -3'
Posted On2013-05-23