Mutagenetix > Incidental Mutations

Incidental Mutation 'R0280:Polb'

37459

Institutional Source

Beutler Lab

Gene Symbol

Polb

Ensembl Gene

ENSMUSG00000031536

Gene Name

polymerase (DNA directed), beta

Synonyms

Pol beta, A430088C08Rik

MMRRC Submission

038502-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0280 (G1)

Quality Score

186

Status

Validated

Chromosome

Chromosomal Location

22628126-22653435 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 22640392 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 173 (Y173N)

Ref Sequence

ENSEMBL: ENSMUSP00000033938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033938] [ENSMUST00000210950]

AlphaFold

Q8K409

Predicted Effect

probably damaging
Transcript: ENSMUST00000033938
AA Change: Y173N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000033938
Gene: ENSMUSG00000031536
AA Change: Y173N

Domain	Start	End	E-Value	Type
POLXc	10	334	4.58e-159	SMART
HhH1	57	76	1.91e-1	SMART
HhH1	98	117	1.14e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181668

Predicted Effect

probably benign
Transcript: ENSMUST00000210950

Meta Mutation Damage Score

0.4141

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.9%
20x: 94.6%

Validation Efficiency

96% (55/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA polymerase involved in base excision and repair, also called gap-filling DNA synthesis. The encoded protein, acting as a monomer, is normally found in the cytoplasm, but it translocates to the nucleus upon DNA damage. Several transcript variants of this gene exist, but the full-length nature of only one has been described to date. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for one knock-out allele die from E10.5 to birth and those for another one exhibit embryonic growth retardation, abnormal neurogenesis, and neonatal lethality due to respiratory failure. Hypomorphic allele mice develop systemic lupus erythematosus-like phentoypes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
Adam18	C	T	8: 24,674,054	G38R	probably benign	Het
Ankrd16	T	G	2: 11,781,501	V187G	probably damaging	Het
AU019823	T	C	9: 50,609,379	T123A	probably damaging	Het
Ccdc110	A	T	8: 45,943,450	N793Y	probably benign	Het
Ccdc170	T	C	10: 4,558,663	I629T	possibly damaging	Het
Clcn6	A	G	4: 148,008,715	L836P	probably damaging	Het
Colgalt2	G	T	1: 152,508,561	A551S	possibly damaging	Het
Crocc	T	C	4: 141,028,426	E1097G	probably damaging	Het
Csmd1	A	T	8: 16,271,602	V494E	probably damaging	Het
Drg1	A	T	11: 3,256,537		probably null	Het
Dscam	T	C	16: 97,039,006	K134E	possibly damaging	Het
Dyrk1b	T	C	7: 28,184,312	Y198H	probably damaging	Het
Esr1	A	G	10: 4,856,951	D289G	probably benign	Het
Esr1	G	T	10: 4,939,289	V396F	probably damaging	Het
Evi5l	T	C	8: 4,193,133	V339A	probably damaging	Het
Fat4	A	T	3: 38,890,816	Q1286L	probably benign	Het
Frem1	T	C	4: 82,969,444	H1118R	probably damaging	Het
Fuk	A	T	8: 110,894,748	V188D	probably damaging	Het
Fut9	C	T	4: 25,619,852	D321N	probably benign	Het
Gaa	T	G	11: 119,284,547	V917G	probably damaging	Het
Gm973	GCC	GC	1: 59,544,680		probably null	Het
Kidins220	A	G	12: 25,010,141	T767A	probably damaging	Het
Kif7	A	G	7: 79,698,823	S1257P	probably benign	Het
Ltn1	A	G	16: 87,397,838	L1391P	probably damaging	Het
Mast3	A	G	8: 70,783,795	Y681H	probably damaging	Het
Mast3	A	G	8: 70,787,920	V291A	possibly damaging	Het
Metrn	C	T	17: 25,795,135	R239H	probably benign	Het
Mphosph10	C	A	7: 64,376,703	K666N	possibly damaging	Het
Mtbp	C	T	15: 55,586,461	T433I	probably benign	Het
Mtmr2	A	G	9: 13,799,249	K365E	probably damaging	Het
Nanog	A	G	6: 122,713,398	D229G	probably damaging	Het
Npepps	T	C	11: 97,241,014	N338S	possibly damaging	Het
Nphp4	T	A	4: 152,551,936		probably benign	Het
Olfr1279	T	C	2: 111,307,072	F289S	possibly damaging	Het
Plcl2	A	G	17: 50,607,034	E357G	probably damaging	Het
R3hdm1	T	A	1: 128,162,775	S74T	probably benign	Het
Raet1d	T	A	10: 22,370,883	C37S	probably damaging	Het
Reln	G	A	5: 22,227,513		probably benign	Het
Rps6kc1	T	C	1: 190,809,000	S369G	probably damaging	Het
Sgf29	A	G	7: 126,671,571	E108G	probably benign	Het
Sh3tc1	A	G	5: 35,706,017	L942P	probably damaging	Het
Slc22a27	A	T	19: 7,896,822	L188*	probably null	Het
Slc9a3	T	A	13: 74,159,424	I445N	probably damaging	Het
Sufu	A	T	19: 46,450,673		probably benign	Het
Tomm40	G	A	7: 19,713,751	T118I	probably damaging	Het
Ttc25	A	T	11: 100,550,265	K107N	probably damaging	Het
Ttn	C	T	2: 76,740,479	R26690H	probably damaging	Het
Vmn2r16	A	G	5: 109,340,139	I293V	possibly damaging	Het
Vmn2r68	T	A	7: 85,233,249		probably benign	Het
Vmn2r68	C	G	7: 85,233,258		probably null	Het
Vsig8	A	G	1: 172,561,538	D119G	probably benign	Het

Other mutations in Polb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01455:Polb	APN	8	22653072	missense	probably damaging	1.00
IGL02421:Polb	APN	8	22640373	missense	probably damaging	1.00
IGL02618:Polb	APN	8	22637093	missense	probably damaging	1.00
IGL02850:Polb	APN	8	22648261	splice site	probably benign
IGL03143:Polb	APN	8	22640351	splice site	probably benign
IGL02796:Polb	UTSW	8	22631458	missense	probably damaging	1.00
R0383:Polb	UTSW	8	22639995	nonsense	probably null
R0788:Polb	UTSW	8	22642338	missense	probably null
R1374:Polb	UTSW	8	22653057	splice site	probably benign
R1564:Polb	UTSW	8	22630341	critical splice donor site	probably null
R2194:Polb	UTSW	8	22647467	missense	probably benign	0.05
R2295:Polb	UTSW	8	22653319	missense	probably damaging	1.00
R2314:Polb	UTSW	8	22640002	missense	possibly damaging	0.69
R4992:Polb	UTSW	8	22645071	missense	probably damaging	0.97
R5107:Polb	UTSW	8	22645046	splice site	probably null
R5474:Polb	UTSW	8	22630370	missense	probably benign	0.13
R5905:Polb	UTSW	8	22639995	nonsense	probably null
R5908:Polb	UTSW	8	22642303	critical splice donor site	probably null
R6028:Polb	UTSW	8	22639995	nonsense	probably null
R6188:Polb	UTSW	8	22647447	missense	probably damaging	0.99
R7304:Polb	UTSW	8	22639959	missense	probably benign
R7644:Polb	UTSW	8	22640427	missense	probably benign	0.02
R7766:Polb	UTSW	8	22653091	missense	probably benign	0.23
R8964:Polb	UTSW	8	22653325	missense	probably damaging	0.96
R9249:Polb	UTSW	8	22653068	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- ACTCAGGTGCAATGACAGAGACAAC -3'
(R):5'- AGCACATCAGAGCCTTCTTCCGTG -3'

Sequencing Primer
(F):5'- TGGGATAAACATGCCCAAGC -3'
(R):5'- CCAGGTGCTTTGATCTATAAACC -3'

Posted On

2013-05-23