Incidental Mutation 'R0280:Adam18'
ID37460
Institutional Source Beutler Lab
Gene Symbol Adam18
Ensembl Gene ENSMUSG00000031552
Gene Namea disintegrin and metallopeptidase domain 18
SynonymsAdam27, Dtgn3
MMRRC Submission 038502-MU
Accession Numbers

Genbank: NM_010084

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0280 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location24602246-24674755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24674054 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 38 (G38R)
Ref Sequence ENSEMBL: ENSMUSP00000133378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033957] [ENSMUST00000033958] [ENSMUST00000167431] [ENSMUST00000170318] [ENSMUST00000173833]
Predicted Effect probably benign
Transcript: ENSMUST00000033957
AA Change: G38R

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000033957
Gene: ENSMUSG00000031552
AA Change: G38R

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 15 140 1.7e-25 PFAM
Pfam:Reprolysin 180 377 1.1e-57 PFAM
DISIN 396 474 1.03e-35 SMART
ACR 475 613 1.12e-51 SMART
transmembrane domain 684 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000033958
SMART Domains Protein: ENSMUSP00000033958
Gene: ENSMUSG00000031553

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 144 3.8e-30 PFAM
Pfam:Reprolysin_5 185 361 6.8e-9 PFAM
Pfam:Reprolysin 187 384 1.6e-64 PFAM
Pfam:Reprolysin_3 211 333 1.2e-8 PFAM
DISIN 404 482 5.58e-32 SMART
ACR 483 614 4.1e-50 SMART
EGF 622 653 1.66e1 SMART
transmembrane domain 689 709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167431
SMART Domains Protein: ENSMUSP00000127479
Gene: ENSMUSG00000031553

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170318
SMART Domains Protein: ENSMUSP00000132620
Gene: ENSMUSG00000031553

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 118 1.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173833
AA Change: G38R

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000133378
Gene: ENSMUSG00000031552
AA Change: G38R

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 15 140 9.5e-35 PFAM
Pfam:Reprolysin 180 378 7.7e-56 PFAM
DISIN 396 474 1.03e-35 SMART
ACR 475 613 1.12e-51 SMART
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is expressed in a regulated fashion during early stages of spermatogenesis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of related ADAM genes on chromosome 8. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice exhibit enhanced motor coordination during inverted screen testing when compared with that of controls. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Ankrd16 T G 2: 11,781,501 V187G probably damaging Het
AU019823 T C 9: 50,609,379 T123A probably damaging Het
Ccdc110 A T 8: 45,943,450 N793Y probably benign Het
Ccdc170 T C 10: 4,558,663 I629T possibly damaging Het
Clcn6 A G 4: 148,008,715 L836P probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crocc T C 4: 141,028,426 E1097G probably damaging Het
Csmd1 A T 8: 16,271,602 V494E probably damaging Het
Drg1 A T 11: 3,256,537 probably null Het
Dscam T C 16: 97,039,006 K134E possibly damaging Het
Dyrk1b T C 7: 28,184,312 Y258H probably damaging Het
Esr1 A G 10: 4,856,951 D289G probably benign Het
Esr1 G T 10: 4,939,289 V396F probably damaging Het
Evi5l T C 8: 4,193,133 V339A probably damaging Het
Fat4 A T 3: 38,890,816 Q1286L probably benign Het
Frem1 T C 4: 82,969,444 H1136R probably damaging Het
Fuk A T 8: 110,894,748 V188D probably damaging Het
Fut9 C T 4: 25,619,852 D321N probably benign Het
Gaa T G 11: 119,284,547 V917G probably damaging Het
Gm973 GCC GC 1: 59,544,680 probably null Het
Kidins220 A G 12: 25,010,141 T767A probably damaging Het
Kif7 A G 7: 79,698,823 S1258P probably benign Het
Ltn1 A G 16: 87,397,838 L1391P probably damaging Het
Mast3 A G 8: 70,783,795 Y697H probably damaging Het
Mast3 A G 8: 70,787,920 V291A possibly damaging Het
Metrn C T 17: 25,795,135 R239H probably benign Het
Mphosph10 C A 7: 64,376,703 K666N possibly damaging Het
Mtbp C T 15: 55,586,461 T433I probably benign Het
Mtmr2 A G 9: 13,799,249 K365E probably damaging Het
Nanog A G 6: 122,713,398 D254G probably damaging Het
Npepps T C 11: 97,241,014 N338S possibly damaging Het
Nphp4 T A 4: 152,551,936 probably benign Het
Olfr1279 T C 2: 111,307,072 F291S possibly damaging Het
Plcl2 A G 17: 50,607,034 E357G probably damaging Het
Polb A T 8: 22,640,392 Y173N probably damaging Het
R3hdm1 T A 1: 128,162,775 S74T probably benign Het
Raet1d T A 10: 22,370,883 C37S probably damaging Het
Reln G A 5: 22,227,513 probably benign Het
Rps6kc1 T C 1: 190,809,000 S369G probably damaging Het
Sgf29 A G 7: 126,671,571 E108G probably benign Het
Sh3tc1 A G 5: 35,706,017 L942P probably damaging Het
Slc22a27 A T 19: 7,896,822 L296* probably null Het
Slc9a3 T A 13: 74,159,424 I445N probably damaging Het
Sufu A T 19: 46,450,673 probably benign Het
Tomm40 G A 7: 19,713,751 T118I probably damaging Het
Ttc25 A T 11: 100,550,265 K107N probably damaging Het
Ttn C T 2: 76,740,479 R26690H probably damaging Het
Vmn2r16 A G 5: 109,340,139 I293V possibly damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Vsig8 A G 1: 172,561,538 D231G probably benign Het
Other mutations in Adam18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Adam18 APN 8 24628133 missense probably damaging 1.00
IGL01649:Adam18 APN 8 24614896 missense possibly damaging 0.82
IGL02212:Adam18 APN 8 24637179 missense probably benign 0.02
IGL02455:Adam18 APN 8 24651848 missense probably damaging 0.96
IGL02525:Adam18 APN 8 24611044 missense probably benign 0.00
IGL02525:Adam18 APN 8 24641767 unclassified probably benign
IGL02966:Adam18 APN 8 24611149 unclassified probably benign
IGL03136:Adam18 APN 8 24641836 missense probably damaging 1.00
G5030:Adam18 UTSW 8 24651856 missense probably benign 0.24
R0135:Adam18 UTSW 8 24665542 missense possibly damaging 0.71
R0389:Adam18 UTSW 8 24629637 splice site probably null
R0390:Adam18 UTSW 8 24674054 missense probably benign 0.06
R0443:Adam18 UTSW 8 24629637 splice site probably null
R0479:Adam18 UTSW 8 24651822 missense probably benign
R0578:Adam18 UTSW 8 24641847 missense possibly damaging 0.82
R0645:Adam18 UTSW 8 24672120 nonsense probably null
R0881:Adam18 UTSW 8 24672143 splice site probably benign
R0885:Adam18 UTSW 8 24651786 missense probably damaging 1.00
R0973:Adam18 UTSW 8 24647853 missense probably benign 0.01
R0973:Adam18 UTSW 8 24647853 missense probably benign 0.01
R0974:Adam18 UTSW 8 24647853 missense probably benign 0.01
R1005:Adam18 UTSW 8 24665514 missense probably benign 0.05
R1356:Adam18 UTSW 8 24668595 splice site probably benign
R1510:Adam18 UTSW 8 24625831 missense probably benign 0.01
R1552:Adam18 UTSW 8 24646361 missense probably benign
R1568:Adam18 UTSW 8 24647783 splice site probably null
R1639:Adam18 UTSW 8 24652152 missense probably benign 0.00
R1968:Adam18 UTSW 8 24646447 missense probably benign 0.32
R2029:Adam18 UTSW 8 24650877 missense probably damaging 1.00
R2058:Adam18 UTSW 8 24672066 splice site probably benign
R2211:Adam18 UTSW 8 24628155 missense probably damaging 0.96
R2237:Adam18 UTSW 8 24646287 missense probably benign 0.01
R2238:Adam18 UTSW 8 24646287 missense probably benign 0.01
R2239:Adam18 UTSW 8 24646287 missense probably benign 0.01
R2518:Adam18 UTSW 8 24637141 missense probably damaging 1.00
R3122:Adam18 UTSW 8 24628232 missense possibly damaging 0.74
R3426:Adam18 UTSW 8 24667604 missense probably damaging 1.00
R3428:Adam18 UTSW 8 24667604 missense probably damaging 1.00
R3967:Adam18 UTSW 8 24629710 missense probably benign 0.12
R4833:Adam18 UTSW 8 24674101 missense probably benign 0.01
R4965:Adam18 UTSW 8 24641811 missense probably damaging 1.00
R5249:Adam18 UTSW 8 24625852 missense probably benign 0.00
R5534:Adam18 UTSW 8 24665514 missense probably benign 0.05
R5920:Adam18 UTSW 8 24674075 missense probably damaging 1.00
R6329:Adam18 UTSW 8 24614827 missense probably damaging 1.00
R6450:Adam18 UTSW 8 24629675 missense probably benign 0.05
R6479:Adam18 UTSW 8 24629665 missense probably benign 0.29
R6516:Adam18 UTSW 8 24674687 missense probably damaging 1.00
R6603:Adam18 UTSW 8 24665502 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ATTTGCACATCGGGTCCTCGTC -3'
(R):5'- AACACGGCTTGGAATGGGACTAC -3'

Sequencing Primer
(F):5'- CATCGGGTCCTCGTCATGTAG -3'
(R):5'- TGGGACTACCACGGATTCAG -3'
Posted On2013-05-23