Incidental Mutation 'R4862:Krt28'
ID 374601
Institutional Source Beutler Lab
Gene Symbol Krt28
Ensembl Gene ENSMUSG00000055937
Gene Name keratin 28
Synonyms
MMRRC Submission 043260-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R4862 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 99364872-99374903 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 99365110 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 441 (I441N)
Ref Sequence ENSEMBL: ENSMUSP00000006963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006963]
AlphaFold A6BLY7
Predicted Effect possibly damaging
Transcript: ENSMUST00000006963
AA Change: I441N

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000006963
Gene: ENSMUSG00000055937
AA Change: I441N

DomainStartEndE-ValueType
low complexity region 23 44 N/A INTRINSIC
Filament 83 398 4.6e-144 SMART
Meta Mutation Damage Score 0.1679 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T G 6: 41,032,411 D163A possibly damaging Het
5330417C22Rik A G 3: 108,467,833 S573P probably benign Het
Acox3 A G 5: 35,589,739 T167A probably benign Het
Aox1 T G 1: 58,095,157 D1096E probably damaging Het
Arid4a A T 12: 71,075,947 D1034V probably damaging Het
Chaf1b T A 16: 93,887,134 L91Q probably damaging Het
Copb2 G T 9: 98,581,267 D512Y probably damaging Het
Daam1 A G 12: 71,942,207 E127G unknown Het
Dhx16 A G 17: 35,883,262 I422V probably benign Het
Dnah6 C T 6: 73,121,788 V2043I probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync2h1 A G 9: 7,147,717 V971A probably benign Het
Elmo1 A G 13: 20,449,512 H448R probably benign Het
Fndc1 A T 17: 7,769,735 V1165D unknown Het
Gm8251 G A 1: 44,058,018 P1307S possibly damaging Het
Hapln1 G A 13: 89,601,452 G39S possibly damaging Het
Igkv6-13 C A 6: 70,457,781 V27L probably benign Het
Lgr5 A T 10: 115,462,764 D286E probably damaging Het
Mapkap1 A G 2: 34,623,430 Y448C probably damaging Het
Olfr1094 T A 2: 86,829,532 V260E probably damaging Het
Olfr453 T C 6: 42,744,555 Y173H possibly damaging Het
Ppt1 A C 4: 122,844,449 N89T probably damaging Het
Ptgs1 G T 2: 36,237,255 R51L probably damaging Het
Slc47a2 A G 11: 61,313,694 F277S possibly damaging Het
Smcr8 A G 11: 60,778,071 E15G probably benign Het
Tbce A G 13: 13,998,419 S476P possibly damaging Het
Tmem131l A T 3: 83,898,210 probably benign Het
Unc5c T C 3: 141,789,773 Y468H probably damaging Het
Ush1c A T 7: 46,229,240 L117H probably damaging Het
Wdfy4 A G 14: 33,100,903 probably null Het
Zfa-ps G T 10: 52,543,096 noncoding transcript Het
Zfat C A 15: 68,180,110 A605S probably benign Het
Zfp853 T A 5: 143,289,661 Q68L unknown Het
Zfyve16 G A 13: 92,508,256 T1146I probably damaging Het
Other mutations in Krt28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Krt28 APN 11 99371468 missense probably benign 0.00
IGL01568:Krt28 APN 11 99371417 missense probably damaging 1.00
IGL01590:Krt28 APN 11 99374394 critical splice donor site probably null
R1250:Krt28 UTSW 11 99366822 critical splice donor site probably null
R1488:Krt28 UTSW 11 99365171 missense probably benign 0.01
R2116:Krt28 UTSW 11 99365117 missense probably benign 0.27
R4244:Krt28 UTSW 11 99374550 missense probably damaging 1.00
R4928:Krt28 UTSW 11 99374632 missense probably benign 0.00
R5035:Krt28 UTSW 11 99366824 missense probably benign 0.00
R5568:Krt28 UTSW 11 99371384 missense probably damaging 1.00
R5642:Krt28 UTSW 11 99374494 missense probably damaging 1.00
R5873:Krt28 UTSW 11 99366890 missense probably damaging 1.00
R6053:Krt28 UTSW 11 99371201 missense probably benign 0.05
R6548:Krt28 UTSW 11 99367013 missense probably damaging 1.00
R7194:Krt28 UTSW 11 99374404 nonsense probably null
R7863:Krt28 UTSW 11 99365173 missense possibly damaging 0.65
R7986:Krt28 UTSW 11 99366825 missense probably benign 0.00
R8415:Krt28 UTSW 11 99374800 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCCAGCATCCTTTGAAAGTC -3'
(R):5'- GGAATGTTCTCCAGACACCC -3'

Sequencing Primer
(F):5'- CAGCATCCTTTGAAAGTCACTAAG -3'
(R):5'- ACACCCTCCCCAATGTGTG -3'
Posted On 2016-03-17