Incidental Mutation 'R4862:Dhx16'
ID 374612
Institutional Source Beutler Lab
Gene Symbol Dhx16
Ensembl Gene ENSMUSG00000024422
Gene Name DEAH-box helicase 16
Synonyms DBP2, DEAH (Asp-Glu-Ala-His) box polypeptide 16, Ddx16, 2410006N22Rik
MMRRC Submission 043260-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4862 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 36190711-36203562 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36194154 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 422 (I422V)
Ref Sequence ENSEMBL: ENSMUSP00000133888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025292] [ENSMUST00000174366]
AlphaFold G3X8X0
Predicted Effect probably benign
Transcript: ENSMUST00000025292
AA Change: I422V

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000025292
Gene: ENSMUSG00000024422
AA Change: I422V

DomainStartEndE-ValueType
Blast:DEXDc 55 310 6e-57 BLAST
DEXDc 400 585 7.26e-33 SMART
HELICc 636 733 1.7e-15 SMART
HA2 794 885 2.24e-31 SMART
Pfam:OB_NTP_bind 901 1018 3.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174330
Predicted Effect probably benign
Transcript: ENSMUST00000174366
AA Change: I422V

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133888
Gene: ENSMUSG00000024422
AA Change: I422V

DomainStartEndE-ValueType
Blast:DEXDc 55 310 9e-58 BLAST
DEXDc 400 585 7.26e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174449
Meta Mutation Damage Score 0.1024 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a functional homolog of fission yeast Prp8 protein involved in cell cycle progression. This gene is mapped to the MHC region on chromosome 6p21.3, a region where many malignant, genetic and autoimmune disease genes are linked. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 A G 5: 35,747,083 (GRCm39) T167A probably benign Het
Aox1 T G 1: 58,134,316 (GRCm39) D1096E probably damaging Het
Arid4a A T 12: 71,122,721 (GRCm39) D1034V probably damaging Het
Ccdc168 G A 1: 44,097,178 (GRCm39) P1307S possibly damaging Het
Chaf1b T A 16: 93,684,022 (GRCm39) L91Q probably damaging Het
Copb2 G T 9: 98,463,320 (GRCm39) D512Y probably damaging Het
Daam1 A G 12: 71,988,981 (GRCm39) E127G unknown Het
Dnah6 C T 6: 73,098,771 (GRCm39) V2043I probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Dync2h1 A G 9: 7,147,717 (GRCm39) V971A probably benign Het
Elapor1 A G 3: 108,375,149 (GRCm39) S573P probably benign Het
Elmo1 A G 13: 20,633,682 (GRCm39) H448R probably benign Het
Fndc1 A T 17: 7,988,567 (GRCm39) V1165D unknown Het
Hapln1 G A 13: 89,749,571 (GRCm39) G39S possibly damaging Het
Igkv6-13 C A 6: 70,434,765 (GRCm39) V27L probably benign Het
Krt28 A T 11: 99,255,936 (GRCm39) I441N possibly damaging Het
Lgr5 A T 10: 115,298,669 (GRCm39) D286E probably damaging Het
Mapkap1 A G 2: 34,513,442 (GRCm39) Y448C probably damaging Het
Or2f1 T C 6: 42,721,489 (GRCm39) Y173H possibly damaging Het
Or5t9 T A 2: 86,659,876 (GRCm39) V260E probably damaging Het
Ppt1 A C 4: 122,738,242 (GRCm39) N89T probably damaging Het
Prss3b T G 6: 41,009,345 (GRCm39) D163A possibly damaging Het
Ptgs1 G T 2: 36,127,267 (GRCm39) R51L probably damaging Het
Slc47a2 A G 11: 61,204,520 (GRCm39) F277S possibly damaging Het
Smcr8 A G 11: 60,668,897 (GRCm39) E15G probably benign Het
Tbce A G 13: 14,173,004 (GRCm39) S476P possibly damaging Het
Tmem131l A T 3: 83,805,517 (GRCm39) probably benign Het
Unc5c T C 3: 141,495,534 (GRCm39) Y468H probably damaging Het
Ush1c A T 7: 45,878,664 (GRCm39) L117H probably damaging Het
Wdfy4 A G 14: 32,822,860 (GRCm39) probably null Het
Zfa-ps G T 10: 52,419,192 (GRCm39) noncoding transcript Het
Zfat C A 15: 68,051,959 (GRCm39) A605S probably benign Het
Zfp853 T A 5: 143,275,416 (GRCm39) Q68L unknown Het
Zfyve16 G A 13: 92,644,764 (GRCm39) T1146I probably damaging Het
Other mutations in Dhx16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Dhx16 APN 17 36,198,826 (GRCm39) missense probably benign 0.02
IGL01533:Dhx16 APN 17 36,192,939 (GRCm39) missense probably damaging 1.00
IGL01743:Dhx16 APN 17 36,199,000 (GRCm39) missense probably damaging 1.00
IGL01946:Dhx16 APN 17 36,196,396 (GRCm39) missense probably benign 0.01
IGL02170:Dhx16 APN 17 36,200,361 (GRCm39) missense probably damaging 1.00
IGL02327:Dhx16 APN 17 36,194,717 (GRCm39) missense probably benign 0.00
IGL02334:Dhx16 APN 17 36,194,949 (GRCm39) missense probably damaging 1.00
IGL02417:Dhx16 APN 17 36,203,429 (GRCm39) missense probably damaging 1.00
R0403:Dhx16 UTSW 17 36,193,942 (GRCm39) critical splice donor site probably null
R0410:Dhx16 UTSW 17 36,201,859 (GRCm39) missense probably damaging 1.00
R0544:Dhx16 UTSW 17 36,192,551 (GRCm39) missense probably benign 0.35
R0835:Dhx16 UTSW 17 36,192,581 (GRCm39) missense probably damaging 1.00
R0845:Dhx16 UTSW 17 36,194,194 (GRCm39) missense probably damaging 1.00
R1642:Dhx16 UTSW 17 36,201,957 (GRCm39) missense probably damaging 1.00
R1833:Dhx16 UTSW 17 36,196,511 (GRCm39) missense probably benign 0.36
R1905:Dhx16 UTSW 17 36,199,247 (GRCm39) missense probably benign
R2233:Dhx16 UTSW 17 36,198,778 (GRCm39) missense probably damaging 1.00
R2234:Dhx16 UTSW 17 36,198,778 (GRCm39) missense probably damaging 1.00
R4647:Dhx16 UTSW 17 36,196,527 (GRCm39) missense probably benign 0.10
R4648:Dhx16 UTSW 17 36,196,527 (GRCm39) missense probably benign 0.10
R4665:Dhx16 UTSW 17 36,190,835 (GRCm39) missense probably damaging 1.00
R4674:Dhx16 UTSW 17 36,196,831 (GRCm39) missense probably damaging 1.00
R5089:Dhx16 UTSW 17 36,194,981 (GRCm39) missense probably damaging 1.00
R5122:Dhx16 UTSW 17 36,194,202 (GRCm39) missense probably damaging 1.00
R5665:Dhx16 UTSW 17 36,201,978 (GRCm39) nonsense probably null
R5748:Dhx16 UTSW 17 36,194,206 (GRCm39) missense probably damaging 1.00
R5763:Dhx16 UTSW 17 36,192,580 (GRCm39) missense possibly damaging 0.87
R5956:Dhx16 UTSW 17 36,193,762 (GRCm39) missense probably damaging 0.96
R6001:Dhx16 UTSW 17 36,194,766 (GRCm39) missense probably damaging 1.00
R6216:Dhx16 UTSW 17 36,193,864 (GRCm39) missense possibly damaging 0.49
R6420:Dhx16 UTSW 17 36,193,906 (GRCm39) missense possibly damaging 0.92
R6467:Dhx16 UTSW 17 36,197,076 (GRCm39) missense probably damaging 1.00
R7326:Dhx16 UTSW 17 36,197,052 (GRCm39) missense probably damaging 1.00
R7338:Dhx16 UTSW 17 36,199,036 (GRCm39) missense probably damaging 1.00
R7457:Dhx16 UTSW 17 36,201,952 (GRCm39) missense probably damaging 1.00
R7736:Dhx16 UTSW 17 36,192,568 (GRCm39) missense possibly damaging 0.79
R8508:Dhx16 UTSW 17 36,196,812 (GRCm39) missense probably damaging 1.00
R8552:Dhx16 UTSW 17 36,192,183 (GRCm39) missense possibly damaging 0.83
R8733:Dhx16 UTSW 17 36,192,267 (GRCm39) missense probably benign 0.13
R8831:Dhx16 UTSW 17 36,199,000 (GRCm39) missense probably damaging 1.00
R9014:Dhx16 UTSW 17 36,193,490 (GRCm39) missense probably benign 0.00
R9194:Dhx16 UTSW 17 36,200,173 (GRCm39) missense probably benign 0.01
R9350:Dhx16 UTSW 17 36,200,203 (GRCm39) missense probably damaging 1.00
R9625:Dhx16 UTSW 17 36,193,413 (GRCm39) missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- ACCATCGAGTTTGTCCGTGC -3'
(R):5'- AGTGTCCTCATCAGTCTCAAAAG -3'

Sequencing Primer
(F):5'- TGACTCGAGGGCCTCTAAAG -3'
(R):5'- AAGCCTCATGACTTAGCGG -3'
Posted On 2016-03-17