Incidental Mutation 'R0280:Mast3'
ID 37462
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Name microtubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission 038502-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0280 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 71230761-71257681 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71236439 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 681 (Y681H)
Ref Sequence ENSEMBL: ENSMUSP00000148686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948]
AlphaFold Q3U214
Predicted Effect probably damaging
Transcript: ENSMUST00000166004
AA Change: Y697H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: Y697H

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211948
AA Change: Y681H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000212140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212172
Meta Mutation Damage Score 0.1169 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 96% (55/57)
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg3 T A 17: 57,192,169 (GRCm39) Y577* probably null Het
Adam18 C T 8: 25,164,070 (GRCm39) G38R probably benign Het
Ankrd16 T G 2: 11,786,312 (GRCm39) V187G probably damaging Het
Ccdc110 A T 8: 46,396,487 (GRCm39) N793Y probably benign Het
Ccdc170 T C 10: 4,508,663 (GRCm39) I629T possibly damaging Het
Clcn6 A G 4: 148,093,172 (GRCm39) L836P probably damaging Het
Colgalt2 G T 1: 152,384,312 (GRCm39) A551S possibly damaging Het
Crocc T C 4: 140,755,737 (GRCm39) E1097G probably damaging Het
Csmd1 A T 8: 16,321,616 (GRCm39) V494E probably damaging Het
Drg1 A T 11: 3,206,537 (GRCm39) probably null Het
Dscam T C 16: 96,840,206 (GRCm39) K134E possibly damaging Het
Dyrk1b T C 7: 27,883,737 (GRCm39) Y198H probably damaging Het
Esr1 A G 10: 4,806,951 (GRCm39) D289G probably benign Het
Esr1 G T 10: 4,889,289 (GRCm39) V396F probably damaging Het
Evi5l T C 8: 4,243,133 (GRCm39) V339A probably damaging Het
Fat4 A T 3: 38,944,965 (GRCm39) Q1286L probably benign Het
Fcsk A T 8: 111,621,380 (GRCm39) V188D probably damaging Het
Frem1 T C 4: 82,887,681 (GRCm39) H1118R probably damaging Het
Fut9 C T 4: 25,619,852 (GRCm39) D321N probably benign Het
Gaa T G 11: 119,175,373 (GRCm39) V917G probably damaging Het
Gm973 GCC GC 1: 59,583,839 (GRCm39) probably null Het
Kidins220 A G 12: 25,060,140 (GRCm39) T767A probably damaging Het
Kif7 A G 7: 79,348,571 (GRCm39) S1257P probably benign Het
Ltn1 A G 16: 87,194,726 (GRCm39) L1391P probably damaging Het
Metrn C T 17: 26,014,109 (GRCm39) R239H probably benign Het
Mphosph10 C A 7: 64,026,451 (GRCm39) K666N possibly damaging Het
Mtbp C T 15: 55,449,857 (GRCm39) T433I probably benign Het
Mtmr2 A G 9: 13,710,545 (GRCm39) K365E probably damaging Het
Nanog A G 6: 122,690,357 (GRCm39) D229G probably damaging Het
Nkapd1 T C 9: 50,520,679 (GRCm39) T123A probably damaging Het
Npepps T C 11: 97,131,840 (GRCm39) N338S possibly damaging Het
Nphp4 T A 4: 152,636,393 (GRCm39) probably benign Het
Odad4 A T 11: 100,441,091 (GRCm39) K107N probably damaging Het
Or4g16 T C 2: 111,137,417 (GRCm39) F289S possibly damaging Het
Plcl2 A G 17: 50,914,062 (GRCm39) E357G probably damaging Het
Polb A T 8: 23,130,408 (GRCm39) Y173N probably damaging Het
R3hdm1 T A 1: 128,090,512 (GRCm39) S74T probably benign Het
Raet1d T A 10: 22,246,782 (GRCm39) C37S probably damaging Het
Reln G A 5: 22,432,511 (GRCm39) probably benign Het
Rps6kc1 T C 1: 190,541,197 (GRCm39) S369G probably damaging Het
Sgf29 A G 7: 126,270,743 (GRCm39) E108G probably benign Het
Sh3tc1 A G 5: 35,863,361 (GRCm39) L942P probably damaging Het
Slc22a27 A T 19: 7,874,187 (GRCm39) L188* probably null Het
Slc9a3 T A 13: 74,307,543 (GRCm39) I445N probably damaging Het
Sufu A T 19: 46,439,112 (GRCm39) probably benign Het
Tomm40 G A 7: 19,447,676 (GRCm39) T118I probably damaging Het
Ttn C T 2: 76,570,823 (GRCm39) R26690H probably damaging Het
Vmn2r16 A G 5: 109,488,005 (GRCm39) I293V possibly damaging Het
Vmn2r68 T A 7: 84,882,457 (GRCm39) probably benign Het
Vmn2r68 C G 7: 84,882,466 (GRCm39) probably null Het
Vsig8 A G 1: 172,389,105 (GRCm39) D119G probably benign Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 71,233,327 (GRCm39) splice site probably benign
IGL01411:Mast3 APN 8 71,232,227 (GRCm39) missense possibly damaging 0.50
IGL01475:Mast3 APN 8 71,232,174 (GRCm39) missense probably damaging 1.00
IGL01886:Mast3 APN 8 71,234,783 (GRCm39) missense possibly damaging 0.94
IGL02104:Mast3 APN 8 71,240,550 (GRCm39) missense possibly damaging 0.78
IGL02236:Mast3 APN 8 71,241,888 (GRCm39) missense probably benign 0.36
IGL02437:Mast3 APN 8 71,233,202 (GRCm39) missense possibly damaging 0.79
IGL02704:Mast3 APN 8 71,239,519 (GRCm39) missense probably damaging 1.00
IGL03155:Mast3 APN 8 71,241,861 (GRCm39) missense probably damaging 1.00
IGL03366:Mast3 APN 8 71,234,207 (GRCm39) nonsense probably null
gravy UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
stuffing UTSW 8 71,237,441 (GRCm39) frame shift probably null
turkey UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
BB010:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
BB020:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R0037:Mast3 UTSW 8 71,236,343 (GRCm39) critical splice donor site probably null
R0280:Mast3 UTSW 8 71,240,564 (GRCm39) missense possibly damaging 0.65
R0731:Mast3 UTSW 8 71,233,965 (GRCm39) missense probably damaging 1.00
R1101:Mast3 UTSW 8 71,239,307 (GRCm39) missense probably damaging 1.00
R1177:Mast3 UTSW 8 71,232,968 (GRCm39) missense probably damaging 1.00
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1333:Mast3 UTSW 8 71,233,938 (GRCm39) missense probably damaging 1.00
R1543:Mast3 UTSW 8 71,244,955 (GRCm39) missense possibly damaging 0.93
R1544:Mast3 UTSW 8 71,238,816 (GRCm39) missense probably damaging 1.00
R1738:Mast3 UTSW 8 71,237,200 (GRCm39) missense probably benign 0.38
R1842:Mast3 UTSW 8 71,233,037 (GRCm39) missense possibly damaging 0.91
R1936:Mast3 UTSW 8 71,237,444 (GRCm39) missense probably damaging 1.00
R2015:Mast3 UTSW 8 71,240,007 (GRCm39) missense probably benign 0.00
R2219:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R2220:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R3711:Mast3 UTSW 8 71,232,251 (GRCm39) missense probably benign 0.13
R3919:Mast3 UTSW 8 71,232,066 (GRCm39) missense probably benign 0.02
R4027:Mast3 UTSW 8 71,240,552 (GRCm39) missense probably damaging 1.00
R4060:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4061:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4062:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4063:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4588:Mast3 UTSW 8 71,233,251 (GRCm39) nonsense probably null
R4672:Mast3 UTSW 8 71,237,441 (GRCm39) frame shift probably null
R4770:Mast3 UTSW 8 71,238,864 (GRCm39) missense probably damaging 1.00
R4822:Mast3 UTSW 8 71,233,010 (GRCm39) missense probably damaging 1.00
R4830:Mast3 UTSW 8 71,241,559 (GRCm39) missense possibly damaging 0.87
R5196:Mast3 UTSW 8 71,240,889 (GRCm39) missense probably damaging 1.00
R5333:Mast3 UTSW 8 71,236,145 (GRCm39) missense probably benign 0.03
R5428:Mast3 UTSW 8 71,237,377 (GRCm39) missense possibly damaging 0.95
R5656:Mast3 UTSW 8 71,238,865 (GRCm39) missense probably damaging 1.00
R5920:Mast3 UTSW 8 71,240,577 (GRCm39) missense probably benign 0.00
R6177:Mast3 UTSW 8 71,242,662 (GRCm39) missense probably damaging 1.00
R6186:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
R6407:Mast3 UTSW 8 71,234,772 (GRCm39) missense probably benign 0.02
R6614:Mast3 UTSW 8 71,234,610 (GRCm39) missense possibly damaging 0.95
R6804:Mast3 UTSW 8 71,239,376 (GRCm39) missense probably benign 0.29
R6873:Mast3 UTSW 8 71,239,236 (GRCm39) nonsense probably null
R6930:Mast3 UTSW 8 71,252,115 (GRCm39) nonsense probably null
R6948:Mast3 UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
R7084:Mast3 UTSW 8 71,232,117 (GRCm39) missense probably benign 0.14
R7253:Mast3 UTSW 8 71,242,326 (GRCm39) critical splice donor site probably null
R7316:Mast3 UTSW 8 71,232,432 (GRCm39) missense probably damaging 1.00
R7357:Mast3 UTSW 8 71,237,503 (GRCm39) missense probably damaging 1.00
R7405:Mast3 UTSW 8 71,238,815 (GRCm39) missense probably damaging 1.00
R7429:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7430:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7521:Mast3 UTSW 8 71,241,412 (GRCm39) missense probably benign 0.16
R7576:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R7933:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R7998:Mast3 UTSW 8 71,236,214 (GRCm39) missense probably benign
R8021:Mast3 UTSW 8 71,240,896 (GRCm39) missense probably benign 0.02
R8204:Mast3 UTSW 8 71,240,925 (GRCm39) missense probably benign 0.00
R8327:Mast3 UTSW 8 71,232,062 (GRCm39) missense probably damaging 1.00
R8357:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8415:Mast3 UTSW 8 71,233,866 (GRCm39) missense probably damaging 1.00
R8457:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8530:Mast3 UTSW 8 71,240,877 (GRCm39) missense possibly damaging 0.92
R8891:Mast3 UTSW 8 71,233,801 (GRCm39) missense probably damaging 1.00
R8930:Mast3 UTSW 8 71,234,377 (GRCm39) splice site probably benign
R9002:Mast3 UTSW 8 71,233,904 (GRCm39) missense probably damaging 1.00
R9085:Mast3 UTSW 8 71,249,361 (GRCm39) missense unknown
R9087:Mast3 UTSW 8 71,242,330 (GRCm39) missense possibly damaging 0.93
R9148:Mast3 UTSW 8 71,233,091 (GRCm39) missense probably damaging 0.98
R9364:Mast3 UTSW 8 71,238,826 (GRCm39) missense probably damaging 1.00
R9779:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
Z1177:Mast3 UTSW 8 71,241,682 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCAGGAACTCAGAGCTGCTGTAAAC -3'
(R):5'- TGTGGATGCAGAACAGTGCCTC -3'

Sequencing Primer
(F):5'- CTCTTAATGTCAGTAATGAGGGAACG -3'
(R):5'- AGCAGCCTTGAGACATATCCTTG -3'
Posted On 2013-05-23