Mutagenetix > Incidental Mutations

Incidental Mutation 'R0280:Mast3'

37463

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

038502-MU

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0280 (G1)

Quality Score

160

Status

Validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70787920 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 291 (V291A)

Ref Sequence

ENSEMBL: ENSMUSP00000128703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212001] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166004
AA Change: V291A

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: V291A

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211841

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211948
AA Change: V275A

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)

Predicted Effect

probably benign
Transcript: ENSMUST00000212001

Predicted Effect

probably benign
Transcript: ENSMUST00000212038

Predicted Effect

probably benign
Transcript: ENSMUST00000212140

Predicted Effect

probably benign
Transcript: ENSMUST00000212551

Predicted Effect

probably benign
Transcript: ENSMUST00000212673

Predicted Effect

probably benign
Transcript: ENSMUST00000212757

Predicted Effect

probably benign
Transcript: ENSMUST00000212875

Meta Mutation Damage Score

0.1701

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.9%
20x: 94.6%

Validation Efficiency

96% (55/57)

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
Adam18	C	T	8: 24,674,054	G38R	probably benign	Het
Ankrd16	T	G	2: 11,781,501	V187G	probably damaging	Het
AU019823	T	C	9: 50,609,379	T123A	probably damaging	Het
Ccdc110	A	T	8: 45,943,450	N793Y	probably benign	Het
Ccdc170	T	C	10: 4,558,663	I629T	possibly damaging	Het
Clcn6	A	G	4: 148,008,715	L836P	probably damaging	Het
Colgalt2	G	T	1: 152,508,561	A551S	possibly damaging	Het
Crocc	T	C	4: 141,028,426	E1097G	probably damaging	Het
Csmd1	A	T	8: 16,271,602	V494E	probably damaging	Het
Drg1	A	T	11: 3,256,537		probably null	Het
Dscam	T	C	16: 97,039,006	K134E	possibly damaging	Het
Dyrk1b	T	C	7: 28,184,312	Y198H	probably damaging	Het
Esr1	A	G	10: 4,856,951	D289G	probably benign	Het
Esr1	G	T	10: 4,939,289	V396F	probably damaging	Het
Evi5l	T	C	8: 4,193,133	V339A	probably damaging	Het
Fat4	A	T	3: 38,890,816	Q1286L	probably benign	Het
Frem1	T	C	4: 82,969,444	H1118R	probably damaging	Het
Fuk	A	T	8: 110,894,748	V188D	probably damaging	Het
Fut9	C	T	4: 25,619,852	D321N	probably benign	Het
Gaa	T	G	11: 119,284,547	V917G	probably damaging	Het
Gm973	GCC	GC	1: 59,544,680		probably null	Het
Kidins220	A	G	12: 25,010,141	T767A	probably damaging	Het
Kif7	A	G	7: 79,698,823	S1257P	probably benign	Het
Ltn1	A	G	16: 87,397,838	L1391P	probably damaging	Het
Metrn	C	T	17: 25,795,135	R239H	probably benign	Het
Mphosph10	C	A	7: 64,376,703	K666N	possibly damaging	Het
Mtbp	C	T	15: 55,586,461	T433I	probably benign	Het
Mtmr2	A	G	9: 13,799,249	K365E	probably damaging	Het
Nanog	A	G	6: 122,713,398	D229G	probably damaging	Het
Npepps	T	C	11: 97,241,014	N338S	possibly damaging	Het
Nphp4	T	A	4: 152,551,936		probably benign	Het
Olfr1279	T	C	2: 111,307,072	F289S	possibly damaging	Het
Plcl2	A	G	17: 50,607,034	E357G	probably damaging	Het
Polb	A	T	8: 22,640,392	Y173N	probably damaging	Het
R3hdm1	T	A	1: 128,162,775	S74T	probably benign	Het
Raet1d	T	A	10: 22,370,883	C37S	probably damaging	Het
Reln	G	A	5: 22,227,513		probably benign	Het
Rps6kc1	T	C	1: 190,809,000	S369G	probably damaging	Het
Sgf29	A	G	7: 126,671,571	E108G	probably benign	Het
Sh3tc1	A	G	5: 35,706,017	L942P	probably damaging	Het
Slc22a27	A	T	19: 7,896,822	L188*	probably null	Het
Slc9a3	T	A	13: 74,159,424	I445N	probably damaging	Het
Sufu	A	T	19: 46,450,673		probably benign	Het
Tomm40	G	A	7: 19,713,751	T118I	probably damaging	Het
Ttc25	A	T	11: 100,550,265	K107N	probably damaging	Het
Ttn	C	T	2: 76,740,479	R26690H	probably damaging	Het
Vmn2r16	A	G	5: 109,340,139	I293V	possibly damaging	Het
Vmn2r68	T	A	7: 85,233,249		probably benign	Het
Vmn2r68	C	G	7: 85,233,258		probably null	Het
Vsig8	A	G	1: 172,561,538	D119G	probably benign	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	unclassified	probably null
R1208:Mast3	UTSW	8	70788272	unclassified	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAATTCTTCCGGGTCAAACTCCTGC -3'
(R):5'- TGGGCTTTATCCACCACCAGATCG -3'

Sequencing Primer
(F):5'- CGCGGGAGAAGCTGTGAG -3'
(R):5'- CTATTTCCTGGAGATGCAGGAC -3'

Posted On

2013-05-23