Incidental Mutation 'R4863:Megf6'
ID 374634
Institutional Source Beutler Lab
Gene Symbol Megf6
Ensembl Gene ENSMUSG00000057751
Gene Name multiple EGF-like-domains 6
Synonyms 2600001P17Rik, Egfl3
MMRRC Submission 042473-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4863 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 154255187-154360170 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 154338738 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030897] [ENSMUST00000152159]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000030897
SMART Domains Protein: ENSMUSP00000030897
Gene: ENSMUSG00000057751

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
EGF_CA 122 162 1.54e-6 SMART
EGF_CA 163 203 2.08e-12 SMART
EGF 207 245 5.4e-2 SMART
EGF 249 286 2.39e-3 SMART
EGF_CA 287 327 4.96e-10 SMART
EGF 336 373 1.64e-1 SMART
EGF 377 413 1.99e1 SMART
EGF_CA 414 454 7.4e-9 SMART
EGF 521 554 4.26e0 SMART
EGF_Lam 570 609 1.19e-3 SMART
EGF_like 613 652 5.29e-1 SMART
EGF 642 685 2.2e1 SMART
EGF_Lam 656 697 1.04e-3 SMART
EGF 687 730 1.59e1 SMART
EGF_like 701 742 2.27e0 SMART
EGF_Lam 746 784 1.33e-1 SMART
EGF 783 816 2.85e-1 SMART
EGF_Lam 832 871 3.88e-3 SMART
EGF_Lam 875 915 3.25e-5 SMART
EGF 914 946 4.7e-2 SMART
EGF_like 962 1001 1.69e-1 SMART
EGF 1000 1032 7.02e-1 SMART
EGF_Lam 1048 1087 3.1e-2 SMART
EGF 1077 1118 7.53e-1 SMART
EGF_like 1091 1130 5.59e-1 SMART
EGF 1129 1161 5.04e-2 SMART
EGF_Lam 1177 1216 2.94e-3 SMART
EGF 1206 1248 1.87e1 SMART
EGF_Lam 1220 1260 3.1e-2 SMART
EGF 1259 1291 1.73e0 SMART
EGF 1302 1334 6.55e-1 SMART
EGF 1345 1377 4.39e-2 SMART
EGF_Lam 1393 1432 7.64e-2 SMART
EGF_Lam 1436 1475 2.64e-5 SMART
EGF_like 1465 1506 4.2e1 SMART
EGF_Lam 1479 1518 1.19e-3 SMART
EGF 1517 1549 1.84e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000152159
SMART Domains Protein: ENSMUSP00000121641
Gene: ENSMUSG00000057751

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF_CA 55 95 2.08e-12 SMART
EGF 99 137 5.4e-2 SMART
EGF 141 178 2.39e-3 SMART
EGF_CA 179 219 4.96e-10 SMART
EGF 228 265 1.64e-1 SMART
EGF 269 305 1.99e1 SMART
EGF_CA 306 346 7.4e-9 SMART
EGF 413 446 4.26e0 SMART
EGF_Lam 462 501 1.19e-3 SMART
EGF_like 505 544 5.29e-1 SMART
EGF 534 577 2.2e1 SMART
EGF_Lam 548 589 1.04e-3 SMART
EGF 579 622 1.59e1 SMART
EGF_like 593 634 2.27e0 SMART
EGF_Lam 638 676 1.33e-1 SMART
EGF 675 708 2.85e-1 SMART
EGF_Lam 724 763 3.88e-3 SMART
EGF_Lam 767 807 3.25e-5 SMART
EGF 806 838 4.7e-2 SMART
EGF_Lam 854 893 2.56e-3 SMART
EGF 892 924 2.02e-1 SMART
EGF 935 967 7.13e-2 SMART
EGF 978 1010 1.73e0 SMART
EGF 1021 1053 6.55e-1 SMART
EGF 1064 1096 4.39e-2 SMART
EGF 1107 1139 4.97e-1 SMART
EGF 1159 1191 1.84e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183595
Meta Mutation Damage Score 0.9488 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (105/106)
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 64,210,658 (GRCm39) R190H probably benign Het
Abcc12 T A 8: 87,265,005 (GRCm39) I647F probably damaging Het
Acnat2 C A 4: 49,380,172 (GRCm39) W384L probably damaging Het
Acvr1 A G 2: 58,367,723 (GRCm39) L146P possibly damaging Het
Ankrd16 T A 2: 11,789,127 (GRCm39) M238K probably benign Het
Clmn A T 12: 104,763,353 (GRCm39) I91N probably damaging Het
Cog8 A T 8: 107,776,806 (GRCm39) L523H probably damaging Het
Cpxm2 T A 7: 131,661,476 (GRCm39) K437M probably benign Het
Dhx57 A T 17: 80,560,540 (GRCm39) V999E probably damaging Het
Dnpep T C 1: 75,285,874 (GRCm39) probably benign Het
Dok3 G A 13: 55,671,270 (GRCm39) R434W probably damaging Het
Dpysl5 C T 5: 30,941,687 (GRCm39) H275Y probably benign Het
Ednra A T 8: 78,394,012 (GRCm39) N361K probably damaging Het
Ei24 A T 9: 36,695,861 (GRCm39) S210R probably damaging Het
Erich3 T A 3: 154,470,441 (GRCm39) V158E unknown Het
Fam193a T A 5: 34,623,549 (GRCm39) V1379E possibly damaging Het
Fasn A G 11: 120,699,654 (GRCm39) V2304A probably damaging Het
Fcgbp A C 7: 27,785,769 (GRCm39) D402A probably benign Het
Fkbp14 T C 6: 54,562,930 (GRCm39) probably benign Het
Fnip1 G A 11: 54,406,382 (GRCm39) V1160I possibly damaging Het
Fsd2 T C 7: 81,202,712 (GRCm39) K289R probably null Het
Fuca2 A T 10: 13,381,651 (GRCm39) D188V probably damaging Het
Gfpt2 T C 11: 49,701,797 (GRCm39) V116A probably benign Het
Gm10770 T A 2: 150,020,816 (GRCm39) K234* probably null Het
Gm9887 A G 12: 69,418,763 (GRCm39) probably benign Het
Gtf3c2 A G 5: 31,316,577 (GRCm39) probably benign Het
H2-M10.3 T C 17: 36,677,528 (GRCm39) D250G probably damaging Het
Hapln4 G A 8: 70,537,142 (GRCm39) V26M possibly damaging Het
Hook3 G A 8: 26,528,057 (GRCm39) A611V probably damaging Het
Hr T C 14: 70,809,412 (GRCm39) L1141P probably damaging Het
Ifngr1 T C 10: 19,485,164 (GRCm39) S388P probably damaging Het
Itga3 T A 11: 94,952,793 (GRCm39) Q326L probably damaging Het
Itgb3 T A 11: 104,556,346 (GRCm39) I729N probably damaging Het
Kcnab2 A G 4: 152,486,403 (GRCm39) S132P probably damaging Het
Lama3 C T 18: 12,672,850 (GRCm39) A2481V probably damaging Het
Lama3 T C 18: 12,631,735 (GRCm39) probably benign Het
Lce1e A T 3: 92,615,178 (GRCm39) C56* probably null Het
Lmcd1 T C 6: 112,264,832 (GRCm39) probably benign Het
Lrrc14 T A 15: 76,597,562 (GRCm39) probably null Het
Lypd8l A T 11: 58,503,338 (GRCm39) probably null Het
Map4k5 G A 12: 69,865,212 (GRCm39) P591L probably benign Het
Mapk13 C A 17: 28,995,284 (GRCm39) D168E probably damaging Het
Marf1 A C 16: 13,950,529 (GRCm39) H952Q possibly damaging Het
Mical3 T C 6: 121,010,748 (GRCm39) I411M probably damaging Het
Myo5a A T 9: 75,124,789 (GRCm39) K1781N probably damaging Het
N4bp2 T C 5: 65,965,473 (GRCm39) V1174A probably benign Het
Ncdn A T 4: 126,644,216 (GRCm39) L202Q probably damaging Het
Ncor1 T A 11: 62,283,464 (GRCm39) M408L possibly damaging Het
Nf1 T C 11: 79,300,235 (GRCm39) L249P probably damaging Het
Nlrp9b T A 7: 19,783,521 (GRCm39) probably null Het
Nxpe3 A T 16: 55,669,996 (GRCm39) Y370N probably damaging Het
P2rx2 T A 5: 110,489,434 (GRCm39) T167S probably benign Het
Pcdhb19 G T 18: 37,632,161 (GRCm39) R652L probably benign Het
Pcdhga12 T C 18: 37,901,334 (GRCm39) L722P probably benign Het
Pde6a A T 18: 61,378,663 (GRCm39) I329F probably damaging Het
Pdpr T A 8: 111,828,583 (GRCm39) S29T probably benign Het
Pfkfb3 T C 2: 11,491,123 (GRCm39) D173G probably benign Het
Plcd4 A G 1: 74,604,961 (GRCm39) probably null Het
Polr1g T A 7: 19,091,684 (GRCm39) Q141L probably damaging Het
Pou2f2 A G 7: 24,796,533 (GRCm39) probably benign Het
Ppp1r14c TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGG 10: 3,316,702 (GRCm39) probably benign Het
Ppp1r42 T C 1: 10,073,611 (GRCm39) probably benign Het
Ptpre C T 7: 135,270,861 (GRCm39) H346Y probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rab12 A T 17: 66,805,103 (GRCm39) Y142N probably damaging Het
Rai14 A C 15: 10,572,556 (GRCm39) M857R probably damaging Het
Ranbp2 A G 10: 58,328,243 (GRCm39) K2753R probably damaging Het
Rasa4 A T 5: 136,132,765 (GRCm39) K6* probably null Het
Rasgef1a A G 6: 118,066,100 (GRCm39) M438V probably benign Het
Recql T G 6: 142,304,732 (GRCm39) probably benign Het
Rftn2 A G 1: 55,211,198 (GRCm39) V425A probably benign Het
Ror1 A G 4: 100,267,001 (GRCm39) Y234C probably damaging Het
Sap30l T A 11: 57,696,880 (GRCm39) L70Q probably damaging Het
Scn4a T C 11: 106,210,828 (GRCm39) R1730G probably damaging Het
Serinc5 T G 13: 92,827,488 (GRCm39) I268R probably damaging Het
Sin3b G A 8: 73,471,576 (GRCm39) V432I possibly damaging Het
Slc30a6 T C 17: 74,719,649 (GRCm39) M203T possibly damaging Het
Soat1 T C 1: 156,259,898 (GRCm39) N481S probably damaging Het
Sos2 G A 12: 69,686,928 (GRCm39) T206I probably benign Het
Sp100 G T 1: 85,632,724 (GRCm39) A132S probably benign Het
Sp140l1 C T 1: 85,066,521 (GRCm39) probably benign Het
Spata31d1c T A 13: 65,183,604 (GRCm39) L382* probably null Het
Stard9 T A 2: 120,531,341 (GRCm39) W2533R probably benign Het
Tas2r126 A G 6: 42,412,324 (GRCm39) T286A probably benign Het
Tedc2 T A 17: 24,436,910 (GRCm39) K275M probably damaging Het
Ten1 A T 11: 116,109,057 (GRCm39) K242N probably benign Het
Thoc2l A T 5: 104,665,616 (GRCm39) D46V possibly damaging Het
Tial1 C T 7: 128,056,752 (GRCm39) V1I probably damaging Het
Tle2 G A 10: 81,424,725 (GRCm39) R649H possibly damaging Het
Tmem178 A G 17: 81,252,374 (GRCm39) D86G probably benign Het
Trim29 T A 9: 43,240,872 (GRCm39) D528E possibly damaging Het
Vmn2r61 A T 7: 41,950,132 (GRCm39) T851S probably benign Het
Vmn2r72 T A 7: 85,399,806 (GRCm39) Q414H possibly damaging Het
Yars1 A T 4: 129,083,675 (GRCm39) probably benign Het
Yipf4 A G 17: 74,801,087 (GRCm39) Q135R probably damaging Het
Zfp341 G A 2: 154,487,786 (GRCm39) probably benign Het
Zfp426 T C 9: 20,381,334 (GRCm39) Y536C probably damaging Het
Zp2 T G 7: 119,734,995 (GRCm39) Y430S probably damaging Het
Other mutations in Megf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Megf6 APN 4 154,338,264 (GRCm39) missense probably damaging 1.00
IGL01410:Megf6 APN 4 154,337,020 (GRCm39) critical splice donor site probably null
IGL01512:Megf6 APN 4 154,347,040 (GRCm39) missense possibly damaging 0.64
IGL01824:Megf6 APN 4 154,336,691 (GRCm39) missense probably damaging 1.00
IGL02172:Megf6 APN 4 154,355,149 (GRCm39) missense probably damaging 1.00
IGL02727:Megf6 APN 4 154,337,606 (GRCm39) splice site probably null
IGL02966:Megf6 APN 4 154,338,234 (GRCm39) missense probably damaging 1.00
Didactic UTSW 4 154,339,044 (GRCm39) missense probably damaging 1.00
R0118:Megf6 UTSW 4 154,339,098 (GRCm39) missense probably damaging 0.99
R0220:Megf6 UTSW 4 154,342,672 (GRCm39) missense probably damaging 1.00
R0347:Megf6 UTSW 4 154,339,092 (GRCm39) missense possibly damaging 0.90
R0383:Megf6 UTSW 4 154,349,783 (GRCm39) missense probably benign 0.01
R0417:Megf6 UTSW 4 154,352,424 (GRCm39) missense probably benign 0.06
R0526:Megf6 UTSW 4 154,343,398 (GRCm39) missense probably benign
R0528:Megf6 UTSW 4 154,343,630 (GRCm39) missense probably benign 0.04
R0928:Megf6 UTSW 4 154,261,504 (GRCm39) missense probably damaging 1.00
R1311:Megf6 UTSW 4 154,348,239 (GRCm39) splice site probably null
R1458:Megf6 UTSW 4 154,261,578 (GRCm39) missense probably benign 0.39
R1470:Megf6 UTSW 4 154,336,876 (GRCm39) splice site probably benign
R1476:Megf6 UTSW 4 154,261,578 (GRCm39) missense probably benign 0.39
R1479:Megf6 UTSW 4 154,261,578 (GRCm39) missense probably benign 0.39
R1624:Megf6 UTSW 4 154,261,578 (GRCm39) missense probably benign 0.39
R1626:Megf6 UTSW 4 154,261,578 (GRCm39) missense probably benign 0.39
R1638:Megf6 UTSW 4 154,346,967 (GRCm39) splice site probably benign
R1777:Megf6 UTSW 4 154,355,147 (GRCm39) nonsense probably null
R1831:Megf6 UTSW 4 154,355,134 (GRCm39) missense probably benign 0.00
R1944:Megf6 UTSW 4 154,340,523 (GRCm39) missense possibly damaging 0.75
R1984:Megf6 UTSW 4 154,352,124 (GRCm39) missense probably damaging 1.00
R2109:Megf6 UTSW 4 154,261,578 (GRCm39) missense probably benign 0.39
R2448:Megf6 UTSW 4 154,351,102 (GRCm39) splice site probably null
R2880:Megf6 UTSW 4 154,337,006 (GRCm39) missense probably damaging 1.00
R4032:Megf6 UTSW 4 154,261,550 (GRCm39) nonsense probably null
R4058:Megf6 UTSW 4 154,326,989 (GRCm39) splice site probably benign
R4672:Megf6 UTSW 4 154,333,909 (GRCm39) missense probably damaging 0.99
R4688:Megf6 UTSW 4 154,338,271 (GRCm39) missense probably damaging 0.99
R4752:Megf6 UTSW 4 154,336,895 (GRCm39) missense probably damaging 1.00
R4909:Megf6 UTSW 4 154,349,848 (GRCm39) missense probably damaging 1.00
R4942:Megf6 UTSW 4 154,338,277 (GRCm39) missense probably damaging 1.00
R4981:Megf6 UTSW 4 154,351,907 (GRCm39) missense possibly damaging 0.95
R4990:Megf6 UTSW 4 154,351,683 (GRCm39) missense possibly damaging 0.94
R5001:Megf6 UTSW 4 154,352,517 (GRCm39) missense probably damaging 1.00
R5189:Megf6 UTSW 4 154,336,980 (GRCm39) missense probably benign 0.31
R5210:Megf6 UTSW 4 154,354,273 (GRCm39) intron probably benign
R5220:Megf6 UTSW 4 154,338,295 (GRCm39) critical splice donor site probably null
R5250:Megf6 UTSW 4 154,340,467 (GRCm39) missense possibly damaging 0.65
R5697:Megf6 UTSW 4 154,342,686 (GRCm39) missense probably null 0.15
R5808:Megf6 UTSW 4 154,352,119 (GRCm39) missense probably benign
R5916:Megf6 UTSW 4 154,333,882 (GRCm39) critical splice acceptor site probably null
R6054:Megf6 UTSW 4 154,347,636 (GRCm39) missense probably benign 0.06
R6075:Megf6 UTSW 4 154,347,056 (GRCm39) nonsense probably null
R6515:Megf6 UTSW 4 154,343,376 (GRCm39) missense possibly damaging 0.84
R6599:Megf6 UTSW 4 154,342,544 (GRCm39) splice site probably null
R6811:Megf6 UTSW 4 154,336,618 (GRCm39) missense probably damaging 1.00
R6925:Megf6 UTSW 4 154,339,044 (GRCm39) missense probably damaging 1.00
R7023:Megf6 UTSW 4 154,338,602 (GRCm39) missense possibly damaging 0.95
R7117:Megf6 UTSW 4 154,343,379 (GRCm39) missense possibly damaging 0.78
R7163:Megf6 UTSW 4 154,351,898 (GRCm39) missense probably damaging 0.98
R7345:Megf6 UTSW 4 154,351,772 (GRCm39) missense probably benign
R7580:Megf6 UTSW 4 154,355,201 (GRCm39) nonsense probably null
R7649:Megf6 UTSW 4 154,349,542 (GRCm39) missense probably damaging 0.96
R7702:Megf6 UTSW 4 154,354,927 (GRCm39) missense probably benign 0.00
R8010:Megf6 UTSW 4 154,354,964 (GRCm39) missense probably benign 0.13
R8175:Megf6 UTSW 4 154,353,076 (GRCm39) nonsense probably null
R8231:Megf6 UTSW 4 154,336,975 (GRCm39) missense probably damaging 1.00
R8436:Megf6 UTSW 4 154,349,649 (GRCm39) missense probably damaging 1.00
R8460:Megf6 UTSW 4 154,350,634 (GRCm39) nonsense probably null
R8738:Megf6 UTSW 4 154,352,436 (GRCm39) missense probably benign
R8854:Megf6 UTSW 4 154,352,469 (GRCm39) missense probably damaging 1.00
R8896:Megf6 UTSW 4 154,326,860 (GRCm39) missense probably damaging 0.99
R9098:Megf6 UTSW 4 154,354,160 (GRCm39) missense probably damaging 0.99
R9147:Megf6 UTSW 4 154,339,130 (GRCm39) missense probably benign 0.18
R9148:Megf6 UTSW 4 154,339,130 (GRCm39) missense probably benign 0.18
R9161:Megf6 UTSW 4 154,352,172 (GRCm39) missense probably benign 0.44
R9355:Megf6 UTSW 4 154,338,282 (GRCm39) missense probably damaging 1.00
R9386:Megf6 UTSW 4 154,340,534 (GRCm39) missense probably damaging 1.00
R9404:Megf6 UTSW 4 154,348,225 (GRCm39) missense
R9469:Megf6 UTSW 4 154,335,369 (GRCm39) missense probably damaging 1.00
R9472:Megf6 UTSW 4 154,333,910 (GRCm39) missense probably damaging 1.00
R9777:Megf6 UTSW 4 154,343,617 (GRCm39) missense probably damaging 1.00
Z1177:Megf6 UTSW 4 154,322,283 (GRCm39) missense probably benign 0.12
Z1177:Megf6 UTSW 4 154,354,198 (GRCm39) nonsense probably null
Z1177:Megf6 UTSW 4 154,352,204 (GRCm39) nonsense probably null
Z1177:Megf6 UTSW 4 154,352,139 (GRCm39) missense probably damaging 0.99
Z1177:Megf6 UTSW 4 154,352,138 (GRCm39) missense possibly damaging 0.48
Z1177:Megf6 UTSW 4 154,335,306 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTAGAAGAATCCGTGGTG -3'
(R):5'- TGAACTGGATCCCTAGCCTCAG -3'

Sequencing Primer
(F):5'- CCGTGGTGGACCTGGATG -3'
(R):5'- GGAGATCCCCAGCCTCTAAGTTC -3'
Posted On 2016-03-17