Incidental Mutation 'R0280:Fuk'
ID37464
Institutional Source Beutler Lab
Gene Symbol Fuk
Ensembl Gene ENSMUSG00000033703
Gene Namefucokinase
SynonymsL-fucose kinase, 1110046B12Rik
MMRRC Submission 038502-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R0280 (G1)
Quality Score181
Status Validated
Chromosome8
Chromosomal Location110882456-110902488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110894748 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 188 (V188D)
Ref Sequence ENSEMBL: ENSMUSP00000148787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041382] [ENSMUST00000212971]
Predicted Effect probably damaging
Transcript: ENSMUST00000041382
AA Change: V188D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000039271
Gene: ENSMUSG00000033703
AA Change: V188D

DomainStartEndE-ValueType
low complexity region 22 37 N/A INTRINSIC
Pfam:Fucokinase 94 496 1.7e-101 PFAM
low complexity region 807 821 N/A INTRINSIC
Pfam:GHMP_kinases_N 827 894 3.6e-9 PFAM
Pfam:GHMP_kinases_C 970 1052 1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212568
Predicted Effect probably damaging
Transcript: ENSMUST00000212971
AA Change: V188D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.246 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the GHMP (galacto-, homoserine, mevalonate and phosphomevalonate) kinase family and catalyzes the phosphorylation of L-fucose to form beta-L-fucose 1-phosphate. This enzyme catalyzes the first step in the utilization of free L-fucose in glycoprotein and glycolipid synthesis. L-fucose may be important in mediating a number of cell-cell interactions such as blood group antigen recognition, inflammation, and metastatis. While several transcript variants may exist for this gene, the full-length nature of only one has been described to date. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Adam18 C T 8: 24,674,054 G38R probably benign Het
Ankrd16 T G 2: 11,781,501 V187G probably damaging Het
AU019823 T C 9: 50,609,379 T123A probably damaging Het
Ccdc110 A T 8: 45,943,450 N793Y probably benign Het
Ccdc170 T C 10: 4,558,663 I629T possibly damaging Het
Clcn6 A G 4: 148,008,715 L836P probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crocc T C 4: 141,028,426 E1097G probably damaging Het
Csmd1 A T 8: 16,271,602 V494E probably damaging Het
Drg1 A T 11: 3,256,537 probably null Het
Dscam T C 16: 97,039,006 K134E possibly damaging Het
Dyrk1b T C 7: 28,184,312 Y198H probably damaging Het
Esr1 A G 10: 4,856,951 D289G probably benign Het
Esr1 G T 10: 4,939,289 V396F probably damaging Het
Evi5l T C 8: 4,193,133 V339A probably damaging Het
Fat4 A T 3: 38,890,816 Q1286L probably benign Het
Frem1 T C 4: 82,969,444 H1118R probably damaging Het
Fut9 C T 4: 25,619,852 D321N probably benign Het
Gaa T G 11: 119,284,547 V917G probably damaging Het
Gm973 GCC GC 1: 59,544,680 probably null Het
Kidins220 A G 12: 25,010,141 T767A probably damaging Het
Kif7 A G 7: 79,698,823 S1257P probably benign Het
Ltn1 A G 16: 87,397,838 L1391P probably damaging Het
Mast3 A G 8: 70,783,795 Y681H probably damaging Het
Mast3 A G 8: 70,787,920 V291A possibly damaging Het
Metrn C T 17: 25,795,135 R239H probably benign Het
Mphosph10 C A 7: 64,376,703 K666N possibly damaging Het
Mtbp C T 15: 55,586,461 T433I probably benign Het
Mtmr2 A G 9: 13,799,249 K365E probably damaging Het
Nanog A G 6: 122,713,398 D229G probably damaging Het
Npepps T C 11: 97,241,014 N338S possibly damaging Het
Nphp4 T A 4: 152,551,936 probably benign Het
Olfr1279 T C 2: 111,307,072 F289S possibly damaging Het
Plcl2 A G 17: 50,607,034 E357G probably damaging Het
Polb A T 8: 22,640,392 Y173N probably damaging Het
R3hdm1 T A 1: 128,162,775 S74T probably benign Het
Raet1d T A 10: 22,370,883 C37S probably damaging Het
Reln G A 5: 22,227,513 probably benign Het
Rps6kc1 T C 1: 190,809,000 S369G probably damaging Het
Sgf29 A G 7: 126,671,571 E108G probably benign Het
Sh3tc1 A G 5: 35,706,017 L942P probably damaging Het
Slc22a27 A T 19: 7,896,822 L188* probably null Het
Slc9a3 T A 13: 74,159,424 I445N probably damaging Het
Sufu A T 19: 46,450,673 probably benign Het
Tomm40 G A 7: 19,713,751 T118I probably damaging Het
Ttc25 A T 11: 100,550,265 K107N probably damaging Het
Ttn C T 2: 76,740,479 R26690H probably damaging Het
Vmn2r16 A G 5: 109,340,139 I293V possibly damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Vsig8 A G 1: 172,561,538 D119G probably benign Het
Other mutations in Fuk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Fuk APN 8 110890476 missense possibly damaging 0.75
IGL01963:Fuk APN 8 110893402 missense probably damaging 1.00
IGL01986:Fuk APN 8 110883257 missense probably benign
PIT4283001:Fuk UTSW 8 110887432 missense probably benign 0.05
R0008:Fuk UTSW 8 110884233 splice site probably benign
R0032:Fuk UTSW 8 110892103 missense possibly damaging 0.55
R0032:Fuk UTSW 8 110892103 missense possibly damaging 0.55
R0057:Fuk UTSW 8 110893768 splice site probably benign
R0057:Fuk UTSW 8 110893768 splice site probably benign
R0285:Fuk UTSW 8 110893717 missense probably benign 0.08
R0359:Fuk UTSW 8 110893259 intron probably null
R0587:Fuk UTSW 8 110883325 missense probably damaging 0.98
R1528:Fuk UTSW 8 110883241 missense probably damaging 1.00
R1731:Fuk UTSW 8 110894823 missense probably damaging 0.96
R1907:Fuk UTSW 8 110893378 nonsense probably null
R2152:Fuk UTSW 8 110889072 missense probably benign 0.03
R2154:Fuk UTSW 8 110889072 missense probably benign 0.03
R2392:Fuk UTSW 8 110889724 missense probably benign
R3037:Fuk UTSW 8 110894718 splice site probably null
R3714:Fuk UTSW 8 110887259 missense probably damaging 1.00
R3765:Fuk UTSW 8 110887104 missense probably benign 0.00
R4307:Fuk UTSW 8 110892080 nonsense probably null
R4404:Fuk UTSW 8 110890301 missense probably benign 0.03
R4768:Fuk UTSW 8 110892134 missense probably benign 0.00
R4998:Fuk UTSW 8 110887803 missense probably damaging 0.96
R5009:Fuk UTSW 8 110887830 missense probably damaging 0.99
R5253:Fuk UTSW 8 110883867 missense possibly damaging 0.90
R6257:Fuk UTSW 8 110890545 missense probably benign 0.00
R6430:Fuk UTSW 8 110884116 missense probably benign 0.16
R6536:Fuk UTSW 8 110883879 missense possibly damaging 0.47
R6599:Fuk UTSW 8 110893283 splice site probably null
R6799:Fuk UTSW 8 110893418 missense probably benign
R7051:Fuk UTSW 8 110890339 missense probably damaging 0.97
R7184:Fuk UTSW 8 110887156 missense probably damaging 1.00
R7241:Fuk UTSW 8 110895897 missense probably benign
R7448:Fuk UTSW 8 110890331 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGCTTTAGTCACTGTCACAGCCTC -3'
(R):5'- GGAATGTCCATTTGGCCTTGGAAAC -3'

Sequencing Primer
(F):5'- TGTCACAGCCTCAGCCC -3'
(R):5'- GGAAACTGTATTTCCCTTCCAGAG -3'
Posted On2013-05-23