Incidental Mutation 'R0280:Mtmr2'
ID 37465
Institutional Source Beutler Lab
Gene Symbol Mtmr2
Ensembl Gene ENSMUSG00000031918
Gene Name myotubularin related protein 2
Synonyms 6030445P13Rik
MMRRC Submission 038502-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.434) question?
Stock # R0280 (G1)
Quality Score 192
Status Validated
Chromosome 9
Chromosomal Location 13748410-13806481 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 13799249 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 365 (K365E)
Ref Sequence ENSEMBL: ENSMUSP00000034396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034396] [ENSMUST00000134674] [ENSMUST00000155679]
AlphaFold Q9Z2D1
Predicted Effect probably damaging
Transcript: ENSMUST00000034396
AA Change: K365E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034396
Gene: ENSMUSG00000031918
AA Change: K365E

DomainStartEndE-ValueType
low complexity region 41 55 N/A INTRINSIC
GRAM 65 139 1.57e-11 SMART
Pfam:Myotub-related 192 529 1.7e-152 PFAM
low complexity region 616 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134674
SMART Domains Protein: ENSMUSP00000121933
Gene: ENSMUSG00000031918

DomainStartEndE-ValueType
PDB:1M7R|B 1 62 2e-9 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146901
Predicted Effect probably damaging
Transcript: ENSMUST00000155679
AA Change: K293E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115906
Gene: ENSMUSG00000031918
AA Change: K293E

DomainStartEndE-ValueType
GRAM 3 67 6.19e-10 SMART
Pfam:Myotub-related 119 459 6.7e-152 PFAM
Pfam:Y_phosphatase 266 370 3.9e-6 PFAM
low complexity region 544 559 N/A INTRINSIC
Meta Mutation Damage Score 0.4493 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myotubularin family of phosphoinositide lipid phosphatases. The encoded protein possesses phosphatase activity towards phosphatidylinositol-3-phosphate and phosphatidylinositol-3,5-bisphosphate. Mutations in this gene are a cause of Charcot-Marie-Tooth disease type 4B, an autosomal recessive demyelinating neuropathy. Alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mutants develop progressive neuropathy characterized by myelin outfolding and recurrent loops and depletion of spermatids and spermatocytes from the seminiferous epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Adam18 C T 8: 24,674,054 G38R probably benign Het
Ankrd16 T G 2: 11,781,501 V187G probably damaging Het
AU019823 T C 9: 50,609,379 T123A probably damaging Het
Ccdc110 A T 8: 45,943,450 N793Y probably benign Het
Ccdc170 T C 10: 4,558,663 I629T possibly damaging Het
Clcn6 A G 4: 148,008,715 L836P probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crocc T C 4: 141,028,426 E1097G probably damaging Het
Csmd1 A T 8: 16,271,602 V494E probably damaging Het
Drg1 A T 11: 3,256,537 probably null Het
Dscam T C 16: 97,039,006 K134E possibly damaging Het
Dyrk1b T C 7: 28,184,312 Y198H probably damaging Het
Esr1 A G 10: 4,856,951 D289G probably benign Het
Esr1 G T 10: 4,939,289 V396F probably damaging Het
Evi5l T C 8: 4,193,133 V339A probably damaging Het
Fat4 A T 3: 38,890,816 Q1286L probably benign Het
Frem1 T C 4: 82,969,444 H1118R probably damaging Het
Fuk A T 8: 110,894,748 V188D probably damaging Het
Fut9 C T 4: 25,619,852 D321N probably benign Het
Gaa T G 11: 119,284,547 V917G probably damaging Het
Gm973 GCC GC 1: 59,544,680 probably null Het
Kidins220 A G 12: 25,010,141 T767A probably damaging Het
Kif7 A G 7: 79,698,823 S1257P probably benign Het
Ltn1 A G 16: 87,397,838 L1391P probably damaging Het
Mast3 A G 8: 70,783,795 Y681H probably damaging Het
Mast3 A G 8: 70,787,920 V291A possibly damaging Het
Metrn C T 17: 25,795,135 R239H probably benign Het
Mphosph10 C A 7: 64,376,703 K666N possibly damaging Het
Mtbp C T 15: 55,586,461 T433I probably benign Het
Nanog A G 6: 122,713,398 D229G probably damaging Het
Npepps T C 11: 97,241,014 N338S possibly damaging Het
Nphp4 T A 4: 152,551,936 probably benign Het
Olfr1279 T C 2: 111,307,072 F289S possibly damaging Het
Plcl2 A G 17: 50,607,034 E357G probably damaging Het
Polb A T 8: 22,640,392 Y173N probably damaging Het
R3hdm1 T A 1: 128,162,775 S74T probably benign Het
Raet1d T A 10: 22,370,883 C37S probably damaging Het
Reln G A 5: 22,227,513 probably benign Het
Rps6kc1 T C 1: 190,809,000 S369G probably damaging Het
Sgf29 A G 7: 126,671,571 E108G probably benign Het
Sh3tc1 A G 5: 35,706,017 L942P probably damaging Het
Slc22a27 A T 19: 7,896,822 L188* probably null Het
Slc9a3 T A 13: 74,159,424 I445N probably damaging Het
Sufu A T 19: 46,450,673 probably benign Het
Tomm40 G A 7: 19,713,751 T118I probably damaging Het
Ttc25 A T 11: 100,550,265 K107N probably damaging Het
Ttn C T 2: 76,740,479 R26690H probably damaging Het
Vmn2r16 A G 5: 109,340,139 I293V possibly damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Vsig8 A G 1: 172,561,538 D119G probably benign Het
Other mutations in Mtmr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Mtmr2 APN 9 13785916 missense probably benign 0.45
IGL01328:Mtmr2 APN 9 13801927 nonsense probably null
IGL02305:Mtmr2 APN 9 13795255 missense probably damaging 1.00
IGL03069:Mtmr2 APN 9 13793205 nonsense probably null
PIT4431001:Mtmr2 UTSW 9 13793179 missense probably benign 0.01
R0636:Mtmr2 UTSW 9 13801913 critical splice acceptor site probably null
R0831:Mtmr2 UTSW 9 13796113 missense probably damaging 0.99
R1202:Mtmr2 UTSW 9 13803452 missense probably benign
R1663:Mtmr2 UTSW 9 13803501 missense probably damaging 1.00
R1679:Mtmr2 UTSW 9 13789077 missense probably damaging 1.00
R2086:Mtmr2 UTSW 9 13799952 missense probably damaging 1.00
R2254:Mtmr2 UTSW 9 13796057 missense possibly damaging 0.49
R2255:Mtmr2 UTSW 9 13796057 missense possibly damaging 0.49
R2932:Mtmr2 UTSW 9 13749117 unclassified probably benign
R4172:Mtmr2 UTSW 9 13800062 missense probably damaging 1.00
R4669:Mtmr2 UTSW 9 13795964 missense probably damaging 1.00
R5248:Mtmr2 UTSW 9 13783609 intron probably benign
R5317:Mtmr2 UTSW 9 13793179 missense probably benign 0.01
R5326:Mtmr2 UTSW 9 13788647 missense probably damaging 1.00
R5573:Mtmr2 UTSW 9 13793167 missense probably benign 0.15
R5830:Mtmr2 UTSW 9 13801978 missense probably benign 0.00
R6332:Mtmr2 UTSW 9 13800029 missense probably damaging 0.99
R6638:Mtmr2 UTSW 9 13796133 missense probably damaging 1.00
R6791:Mtmr2 UTSW 9 13805382 missense probably benign 0.02
R7072:Mtmr2 UTSW 9 13788620 missense probably benign 0.00
R7474:Mtmr2 UTSW 9 13799225 missense probably damaging 1.00
R7722:Mtmr2 UTSW 9 13804808 missense probably benign
R8399:Mtmr2 UTSW 9 13792067 missense probably benign 0.01
R9475:Mtmr2 UTSW 9 13805471 missense probably benign
R9567:Mtmr2 UTSW 9 13802005 nonsense probably null
R9618:Mtmr2 UTSW 9 13796019 missense probably benign 0.14
R9782:Mtmr2 UTSW 9 13801997 missense probably benign 0.05
Z1176:Mtmr2 UTSW 9 13799281 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACCCTCCTCAGAGATGTCCTTCAG -3'
(R):5'- GCACACTGTCATTGGCTCCACTAC -3'

Sequencing Primer
(F):5'- ACTAGCACAGGCTGTTTCAG -3'
(R):5'- ATTGGCTCCACTACTCAGTAGG -3'
Posted On 2013-05-23