Mutagenetix > Incidental Mutation

Incidental Mutation 'R4863:Ptpre'

374659

Institutional Source

Beutler Lab

Gene Symbol

Ptpre

Ensembl Gene

ENSMUSG00000041836

Gene Name

protein tyrosine phosphatase, receptor type, E

Synonyms

PTPe, RPTPepsilon, PTPepsilon

MMRRC Submission

042473-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.663) question?

Stock #

R4863 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135537481-135686293 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 135669132 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 346 (H346Y)

Ref Sequence

ENSEMBL: ENSMUSP00000147656 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073961] [ENSMUST00000209256] [ENSMUST00000209979] [ENSMUST00000210833] [ENSMUST00000211140] [ENSMUST00000211788]

AlphaFold

P49446

Predicted Effect

probably benign
Transcript: ENSMUST00000073961
AA Change: H326Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000073616
Gene: ENSMUSG00000041836
AA Change: H326Y

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	25	36	N/A	INTRINSIC
transmembrane domain	48	70	N/A	INTRINSIC
PTPc	133	395	4.65e-136	SMART
PTPc	424	690	7.36e-116	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000209256
AA Change: H346Y

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Predicted Effect

probably benign
Transcript: ENSMUST00000209979
AA Change: H269Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000210833
AA Change: H326Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211092

Predicted Effect

probably benign
Transcript: ENSMUST00000211140
AA Change: H326Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000211788
AA Change: H339Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.0683

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

99% (105/106)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. Several alternatively spliced transcript variants of this gene have been reported, at least two of which encode a receptor-type PTP that possesses a short extracellular domain, a single transmembrane region, and two tandem intracytoplasmic catalytic domains; another one encodes a PTP that contains a distinct hydrophilic N-terminus, and thus represents a nonreceptor-type isoform of this PTP. Studies of the similar gene in mice suggested the regulatory roles of this PTP in RAS related signal transduction pathways, cytokine-induced SATA signaling, as well as the activation of voltage-gated K+ channels. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early-onset peripheral myelination defects, increased activity of voltage-gated potassium channels in Schwann cells, and increased trabecular bone mass due to cell-specific defects in osteoclast function in young females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210407C18Rik	A	T	11: 58,612,512		probably null	Het
4930578I06Rik	C	T	14: 63,973,209	R190H	probably benign	Het
A530032D15Rik	C	T	1: 85,088,800		probably benign	Het
Abcc12	T	A	8: 86,538,376	I647F	probably damaging	Het
Acnat2	C	A	4: 49,380,172	W384L	probably damaging	Het
Acvr1	A	G	2: 58,477,711	L146P	possibly damaging	Het
Ankrd16	T	A	2: 11,784,316	M238K	probably benign	Het
BC005561	A	T	5: 104,517,750	D46V	possibly damaging	Het
Cd3eap	T	A	7: 19,357,759	Q141L	probably damaging	Het
Clmn	A	T	12: 104,797,094	I91N	probably damaging	Het
Cog8	A	T	8: 107,050,174	L523H	probably damaging	Het
Cpxm2	T	A	7: 132,059,747	K437M	probably benign	Het
Dhx57	A	T	17: 80,253,111	V999E	probably damaging	Het
Dnpep	T	C	1: 75,309,230		probably benign	Het
Dok3	G	A	13: 55,523,457	R434W	probably damaging	Het
Dpysl5	C	T	5: 30,784,343	H275Y	probably benign	Het
Ednra	A	T	8: 77,667,383	N361K	probably damaging	Het
Ei24	A	T	9: 36,784,565	S210R	probably damaging	Het
Erich3	T	A	3: 154,764,804	V158E	unknown	Het
Fam193a	T	A	5: 34,466,205	V1379E	possibly damaging	Het
Fasn	A	G	11: 120,808,828	V2304A	probably damaging	Het
Fcgbp	A	C	7: 28,086,344	D402A	probably benign	Het
Fkbp14	T	C	6: 54,585,945		probably benign	Het
Fnip1	G	A	11: 54,515,556	V1160I	possibly damaging	Het
Fsd2	T	C	7: 81,552,964	K289R	probably null	Het
Fuca2	A	T	10: 13,505,907	D188V	probably damaging	Het
Gfpt2	T	C	11: 49,810,970	V116A	probably benign	Het
Gm10770	T	A	2: 150,178,896	K234*	probably null	Het
Gm9887	A	G	12: 69,371,989		probably benign	Het
Gtf3c2	A	G	5: 31,159,233		probably benign	Het
H2-M10.3	T	C	17: 36,366,636	D250G	probably damaging	Het
Hapln4	G	A	8: 70,084,492	V26M	possibly damaging	Het
Hook3	G	A	8: 26,038,029	A611V	probably damaging	Het
Hr	T	C	14: 70,571,972	L1141P	probably damaging	Het
Ifngr1	T	C	10: 19,609,416	S388P	probably damaging	Het
Itga3	T	A	11: 95,061,967	Q326L	probably damaging	Het
Itgb3	T	A	11: 104,665,520	I729N	probably damaging	Het
Kcnab2	A	G	4: 152,401,946	S132P	probably damaging	Het
Lama3	C	T	18: 12,539,793	A2481V	probably damaging	Het
Lama3	T	C	18: 12,498,678		probably benign	Het
Lce1e	A	T	3: 92,707,871	C56*	probably null	Het
Lmcd1	T	C	6: 112,287,871		probably benign	Het
Lrrc14	T	A	15: 76,713,362		probably null	Het
Map4k5	G	A	12: 69,818,438	P591L	probably benign	Het
Mapk13	C	A	17: 28,776,310	D168E	probably damaging	Het
Marf1	A	C	16: 14,132,665	H952Q	possibly damaging	Het
Megf6	T	C	4: 154,254,281		probably null	Het
Mical3	T	C	6: 121,033,787	I411M	probably damaging	Het
Myo5a	A	T	9: 75,217,507	K1781N	probably damaging	Het
N4bp2	T	C	5: 65,808,130	V1174A	probably benign	Het
Ncdn	A	T	4: 126,750,423	L202Q	probably damaging	Het
Ncor1	T	A	11: 62,392,638	M408L	possibly damaging	Het
Nf1	T	C	11: 79,409,409	L249P	probably damaging	Het
Nlrp9b	T	A	7: 20,049,596		probably null	Het
Nxpe3	A	T	16: 55,849,633	Y370N	probably damaging	Het
P2rx2	T	A	5: 110,341,568	T167S	probably benign	Het
Pcdhb19	G	T	18: 37,499,108	R652L	probably benign	Het
Pcdhga12	T	C	18: 37,768,281	L722P	probably benign	Het
Pde6a	A	T	18: 61,245,592	I329F	probably damaging	Het
Pdpr	T	A	8: 111,101,951	S29T	probably benign	Het
Pfkfb3	T	C	2: 11,486,312	D173G	probably benign	Het
Plcd4	A	G	1: 74,565,802		probably null	Het
Pou2f2	A	G	7: 25,097,108		probably benign	Het
Ppp1r14c	TGGCGGCGGCGGCGGCGG	TGGCGGCGGCGGCGG	10: 3,366,702		probably benign	Het
Ppp1r42	T	C	1: 10,003,386		probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rab12	A	T	17: 66,498,108	Y142N	probably damaging	Het
Rai14	A	C	15: 10,572,470	M857R	probably damaging	Het
Ranbp2	A	G	10: 58,492,421	K2753R	probably damaging	Het
Rasa4	A	T	5: 136,103,911	K6*	probably null	Het
Rasgef1a	A	G	6: 118,089,139	M438V	probably benign	Het
Recql	T	G	6: 142,359,006		probably benign	Het
Rftn2	A	G	1: 55,172,039	V425A	probably benign	Het
Ror1	A	G	4: 100,409,804	Y234C	probably damaging	Het
Sap30l	T	A	11: 57,806,054	L70Q	probably damaging	Het
Scn4a	T	C	11: 106,320,002	R1730G	probably damaging	Het
Serinc5	T	G	13: 92,690,980	I268R	probably damaging	Het
Sin3b	G	A	8: 72,744,948	V432I	possibly damaging	Het
Slc30a6	T	C	17: 74,412,654	M203T	possibly damaging	Het
Soat1	T	C	1: 156,432,328	N481S	probably damaging	Het
Sos2	G	A	12: 69,640,154	T206I	probably benign	Het
Sp100	G	T	1: 85,705,003	A132S	probably benign	Het
Spata31d1c	T	A	13: 65,035,790	L382*	probably null	Het
Stard9	T	A	2: 120,700,860	W2533R	probably benign	Het
Tas2r126	A	G	6: 42,435,390	T286A	probably benign	Het
Tedc2	T	A	17: 24,217,936	K275M	probably damaging	Het
Ten1	A	T	11: 116,218,231	K242N	probably benign	Het
Tial1	C	T	7: 128,455,028	V1I	probably damaging	Het
Tle2	G	A	10: 81,588,891	R649H	possibly damaging	Het
Tmem178	A	G	17: 80,944,945	D86G	probably benign	Het
Trim29	T	A	9: 43,329,575	D528E	possibly damaging	Het
Vmn2r61	A	T	7: 42,300,708	T851S	probably benign	Het
Vmn2r72	T	A	7: 85,750,598	Q414H	possibly damaging	Het
Yars	A	T	4: 129,189,882		probably benign	Het
Yipf4	A	G	17: 74,494,092	Q135R	probably damaging	Het
Zfp341	G	A	2: 154,645,866		probably benign	Het
Zfp426	T	C	9: 20,470,038	Y536C	probably damaging	Het
Zp2	T	G	7: 120,135,772	Y430S	probably damaging	Het

Other mutations in Ptpre

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00918:Ptpre	APN	7	135659053	missense	probably damaging	0.98
IGL01019:Ptpre	APN	7	135678325	nonsense	probably null
IGL01115:Ptpre	APN	7	135670764	missense	probably damaging	1.00
IGL01456:Ptpre	APN	7	135669802	missense	probably damaging	1.00
IGL01516:Ptpre	APN	7	135664999	missense	probably damaging	0.97
IGL02108:Ptpre	APN	7	135659102	missense	possibly damaging	0.85
IGL02735:Ptpre	APN	7	135667567	missense	probably damaging	1.00
IGL03326:Ptpre	APN	7	135672817	missense	probably damaging	1.00
IGL03327:Ptpre	APN	7	135672822	critical splice donor site	probably null
R0183:Ptpre	UTSW	7	135669845	missense	probably benign	0.01
R0369:Ptpre	UTSW	7	135670715	missense	probably damaging	1.00
R0538:Ptpre	UTSW	7	135663315	missense	probably damaging	0.99
R0762:Ptpre	UTSW	7	135679235	missense	probably damaging	0.99
R1169:Ptpre	UTSW	7	135667612	missense	probably benign	0.33
R1214:Ptpre	UTSW	7	135679258	missense	probably damaging	1.00
R1629:Ptpre	UTSW	7	135669799	missense	probably damaging	1.00
R1654:Ptpre	UTSW	7	135653928	missense	probably benign	0.32
R1819:Ptpre	UTSW	7	135668993	splice site	probably benign
R1876:Ptpre	UTSW	7	135678317	missense	possibly damaging	0.73
R2049:Ptpre	UTSW	7	135670695	splice site	probably benign
R2284:Ptpre	UTSW	7	135669781	missense	probably benign	0.05
R2895:Ptpre	UTSW	7	135643858	nonsense	probably null
R4508:Ptpre	UTSW	7	135669103	missense	probably damaging	1.00
R4603:Ptpre	UTSW	7	135667643	nonsense	probably null
R4644:Ptpre	UTSW	7	135651932	intron	probably benign
R4989:Ptpre	UTSW	7	135669132	missense	probably benign	0.00
R5015:Ptpre	UTSW	7	135669132	missense	probably benign	0.00
R5133:Ptpre	UTSW	7	135669132	missense	probably benign	0.00
R5134:Ptpre	UTSW	7	135652092	missense	probably damaging	0.96
R5291:Ptpre	UTSW	7	135678301	missense	probably benign
R5372:Ptpre	UTSW	7	135653940	missense	possibly damaging	0.87
R5653:Ptpre	UTSW	7	135653943	missense	probably damaging	0.99
R5896:Ptpre	UTSW	7	135674278	missense	probably benign	0.39
R6238:Ptpre	UTSW	7	135671180	missense	probably damaging	1.00
R6974:Ptpre	UTSW	7	135669148	missense	possibly damaging	0.95
R7125:Ptpre	UTSW	7	135654015	nonsense	probably null
R7298:Ptpre	UTSW	7	135683287	missense	probably damaging	1.00
R7453:Ptpre	UTSW	7	135538074	missense	unknown
R7459:Ptpre	UTSW	7	135667600	missense	probably benign
R7855:Ptpre	UTSW	7	135651995	missense	probably benign
R7970:Ptpre	UTSW	7	135678319	missense	possibly damaging	0.51
R8003:Ptpre	UTSW	7	135669036	missense	probably damaging	0.96
R8768:Ptpre	UTSW	7	135681577	missense	possibly damaging	0.92
R9109:Ptpre	UTSW	7	135669779	missense	probably benign
R9131:Ptpre	UTSW	7	135679146	missense	probably damaging	1.00
R9267:Ptpre	UTSW	7	135672820	missense	probably damaging	1.00
R9541:Ptpre	UTSW	7	135665011	missense	probably benign	0.39

Predicted Primers

PCR Primer
(F):5'- GCATTCCAGGGTTCTCTGTG -3'
(R):5'- GGGGCTAGAATTCCTTTCTCC -3'

Sequencing Primer
(F):5'- CTTCGGAAGGAGATGCTAAACAGTTC -3'
(R):5'- TCCACACGCAACTTTGGG -3'

Posted On

2016-03-17