Incidental Mutation 'R0280:AU019823'
ID 37466
Institutional Source Beutler Lab
Gene Symbol AU019823
Ensembl Gene ENSMUSG00000059820
Gene Name expressed sequence AU019823
Synonyms LOC270156
MMRRC Submission 038502-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.744) question?
Stock # R0280 (G1)
Quality Score 209
Status Validated
Chromosome 9
Chromosomal Location 50605240-50617464 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 50609379 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 123 (T123A)
Ref Sequence ENSEMBL: ENSMUSP00000117265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044051] [ENSMUST00000131351] [ENSMUST00000145139] [ENSMUST00000147671] [ENSMUST00000155435] [ENSMUST00000171462]
AlphaFold E9PUQ3
Predicted Effect probably benign
Transcript: ENSMUST00000044051
SMART Domains Protein: ENSMUSP00000039335
Gene: ENSMUSG00000039016

Pfam:zf-Tim10_DDP 14 76 5.1e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000131351
AA Change: T123A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123319
Gene: ENSMUSG00000059820
AA Change: T123A

low complexity region 142 175 N/A INTRINSIC
low complexity region 198 216 N/A INTRINSIC
low complexity region 224 256 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000145139
AA Change: T123A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably damaging
Transcript: ENSMUST00000147671
AA Change: T123A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117265
Gene: ENSMUSG00000059820
AA Change: T123A

low complexity region 142 175 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000155435
AA Change: T123A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121198
Gene: ENSMUSG00000059820
AA Change: T123A

low complexity region 142 175 N/A INTRINSIC
low complexity region 198 214 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171462
AA Change: T123A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133259
Gene: ENSMUSG00000059820
AA Change: T123A

Pfam:NKAP 86 163 5.2e-26 PFAM
low complexity region 198 216 N/A INTRINSIC
low complexity region 224 256 N/A INTRINSIC
Meta Mutation Damage Score 0.2214 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 96% (55/57)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Adam18 C T 8: 24,674,054 G38R probably benign Het
Ankrd16 T G 2: 11,781,501 V187G probably damaging Het
Ccdc110 A T 8: 45,943,450 N793Y probably benign Het
Ccdc170 T C 10: 4,558,663 I629T possibly damaging Het
Clcn6 A G 4: 148,008,715 L836P probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crocc T C 4: 141,028,426 E1097G probably damaging Het
Csmd1 A T 8: 16,271,602 V494E probably damaging Het
Drg1 A T 11: 3,256,537 probably null Het
Dscam T C 16: 97,039,006 K134E possibly damaging Het
Dyrk1b T C 7: 28,184,312 Y198H probably damaging Het
Esr1 A G 10: 4,856,951 D289G probably benign Het
Esr1 G T 10: 4,939,289 V396F probably damaging Het
Evi5l T C 8: 4,193,133 V339A probably damaging Het
Fat4 A T 3: 38,890,816 Q1286L probably benign Het
Frem1 T C 4: 82,969,444 H1118R probably damaging Het
Fuk A T 8: 110,894,748 V188D probably damaging Het
Fut9 C T 4: 25,619,852 D321N probably benign Het
Gaa T G 11: 119,284,547 V917G probably damaging Het
Gm973 GCC GC 1: 59,544,680 probably null Het
Kidins220 A G 12: 25,010,141 T767A probably damaging Het
Kif7 A G 7: 79,698,823 S1257P probably benign Het
Ltn1 A G 16: 87,397,838 L1391P probably damaging Het
Mast3 A G 8: 70,783,795 Y681H probably damaging Het
Mast3 A G 8: 70,787,920 V291A possibly damaging Het
Metrn C T 17: 25,795,135 R239H probably benign Het
Mphosph10 C A 7: 64,376,703 K666N possibly damaging Het
Mtbp C T 15: 55,586,461 T433I probably benign Het
Mtmr2 A G 9: 13,799,249 K365E probably damaging Het
Nanog A G 6: 122,713,398 D229G probably damaging Het
Npepps T C 11: 97,241,014 N338S possibly damaging Het
Nphp4 T A 4: 152,551,936 probably benign Het
Olfr1279 T C 2: 111,307,072 F289S possibly damaging Het
Plcl2 A G 17: 50,607,034 E357G probably damaging Het
Polb A T 8: 22,640,392 Y173N probably damaging Het
R3hdm1 T A 1: 128,162,775 S74T probably benign Het
Raet1d T A 10: 22,370,883 C37S probably damaging Het
Reln G A 5: 22,227,513 probably benign Het
Rps6kc1 T C 1: 190,809,000 S369G probably damaging Het
Sgf29 A G 7: 126,671,571 E108G probably benign Het
Sh3tc1 A G 5: 35,706,017 L942P probably damaging Het
Slc22a27 A T 19: 7,896,822 L188* probably null Het
Slc9a3 T A 13: 74,159,424 I445N probably damaging Het
Sufu A T 19: 46,450,673 probably benign Het
Tomm40 G A 7: 19,713,751 T118I probably damaging Het
Ttc25 A T 11: 100,550,265 K107N probably damaging Het
Ttn C T 2: 76,740,479 R26690H probably damaging Het
Vmn2r16 A G 5: 109,340,139 I293V possibly damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Vsig8 A G 1: 172,561,538 D119G probably benign Het
Other mutations in AU019823
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02879:AU019823 APN 9 50609371 critical splice donor site probably null
IGL03182:AU019823 APN 9 50612398 missense possibly damaging 0.91
R0021:AU019823 UTSW 9 50610425 missense probably damaging 0.96
R0021:AU019823 UTSW 9 50610425 missense probably damaging 0.96
R0304:AU019823 UTSW 9 50607922 missense probably damaging 0.99
R1438:AU019823 UTSW 9 50607672 missense possibly damaging 0.72
R1613:AU019823 UTSW 9 50607805 missense probably damaging 1.00
R4941:AU019823 UTSW 9 50607509 missense probably benign 0.00
R5983:AU019823 UTSW 9 50607842 missense probably damaging 0.96
R6226:AU019823 UTSW 9 50607770 missense possibly damaging 0.53
R6228:AU019823 UTSW 9 50607671 missense possibly damaging 0.73
R6318:AU019823 UTSW 9 50607461 missense probably benign 0.00
R6923:AU019823 UTSW 9 50610310 missense probably benign
R7841:AU019823 UTSW 9 50610416 missense probably damaging 0.98
R8325:AU019823 UTSW 9 50610308 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cccaagctagactcaaactcc -3'
Posted On 2013-05-23