Incidental Mutation 'R4863:Ei24'
ID 374668
Institutional Source Beutler Lab
Gene Symbol Ei24
Ensembl Gene ENSMUSG00000062762
Gene Name etoposide induced 2.4 mRNA
Synonyms PIG8
MMRRC Submission 042473-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4863 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 36690449-36708630 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 36695861 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 210 (S210R)
Ref Sequence ENSEMBL: ENSMUSP00000132270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115086] [ENSMUST00000163192] [ENSMUST00000184395]
AlphaFold Q61070
Predicted Effect probably damaging
Transcript: ENSMUST00000115086
AA Change: S210R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110738
Gene: ENSMUSG00000062762
AA Change: S210R

DomainStartEndE-ValueType
Pfam:EI24 61 290 2.5e-48 PFAM
low complexity region 331 339 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163192
AA Change: S210R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132270
Gene: ENSMUSG00000062762
AA Change: S210R

DomainStartEndE-ValueType
low complexity region 55 71 N/A INTRINSIC
Pfam:EI24 77 289 3.8e-24 PFAM
low complexity region 331 339 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183430
Predicted Effect probably benign
Transcript: ENSMUST00000184235
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185124
Predicted Effect probably benign
Transcript: ENSMUST00000184395
SMART Domains Protein: ENSMUSP00000139150
Gene: ENSMUSG00000062762

DomainStartEndE-ValueType
Pfam:EI24 58 181 4.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217339
Meta Mutation Damage Score 0.7455 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (105/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative tumor suppressor and has higher expression in p53-expressing cells than in control cells and is an immediate-early induction target of p53-mediated apoptosis. The encoded protein may suppress cell growth by inducing apoptotic cell death through the caspase 9 and mitochondrial pathways. This gene is located on human chromosome 11q24, a region frequently altered in cancers. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene have been defined on chromosomes 1, 3, 7, and 8. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a targeted allele do not survive to the neonatal stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 64,210,658 (GRCm39) R190H probably benign Het
Abcc12 T A 8: 87,265,005 (GRCm39) I647F probably damaging Het
Acnat2 C A 4: 49,380,172 (GRCm39) W384L probably damaging Het
Acvr1 A G 2: 58,367,723 (GRCm39) L146P possibly damaging Het
Ankrd16 T A 2: 11,789,127 (GRCm39) M238K probably benign Het
Clmn A T 12: 104,763,353 (GRCm39) I91N probably damaging Het
Cog8 A T 8: 107,776,806 (GRCm39) L523H probably damaging Het
Cpxm2 T A 7: 131,661,476 (GRCm39) K437M probably benign Het
Dhx57 A T 17: 80,560,540 (GRCm39) V999E probably damaging Het
Dnpep T C 1: 75,285,874 (GRCm39) probably benign Het
Dok3 G A 13: 55,671,270 (GRCm39) R434W probably damaging Het
Dpysl5 C T 5: 30,941,687 (GRCm39) H275Y probably benign Het
Ednra A T 8: 78,394,012 (GRCm39) N361K probably damaging Het
Erich3 T A 3: 154,470,441 (GRCm39) V158E unknown Het
Fam193a T A 5: 34,623,549 (GRCm39) V1379E possibly damaging Het
Fasn A G 11: 120,699,654 (GRCm39) V2304A probably damaging Het
Fcgbp A C 7: 27,785,769 (GRCm39) D402A probably benign Het
Fkbp14 T C 6: 54,562,930 (GRCm39) probably benign Het
Fnip1 G A 11: 54,406,382 (GRCm39) V1160I possibly damaging Het
Fsd2 T C 7: 81,202,712 (GRCm39) K289R probably null Het
Fuca2 A T 10: 13,381,651 (GRCm39) D188V probably damaging Het
Gfpt2 T C 11: 49,701,797 (GRCm39) V116A probably benign Het
Gm10770 T A 2: 150,020,816 (GRCm39) K234* probably null Het
Gm9887 A G 12: 69,418,763 (GRCm39) probably benign Het
Gtf3c2 A G 5: 31,316,577 (GRCm39) probably benign Het
H2-M10.3 T C 17: 36,677,528 (GRCm39) D250G probably damaging Het
Hapln4 G A 8: 70,537,142 (GRCm39) V26M possibly damaging Het
Hook3 G A 8: 26,528,057 (GRCm39) A611V probably damaging Het
Hr T C 14: 70,809,412 (GRCm39) L1141P probably damaging Het
Ifngr1 T C 10: 19,485,164 (GRCm39) S388P probably damaging Het
Itga3 T A 11: 94,952,793 (GRCm39) Q326L probably damaging Het
Itgb3 T A 11: 104,556,346 (GRCm39) I729N probably damaging Het
Kcnab2 A G 4: 152,486,403 (GRCm39) S132P probably damaging Het
Lama3 T C 18: 12,631,735 (GRCm39) probably benign Het
Lama3 C T 18: 12,672,850 (GRCm39) A2481V probably damaging Het
Lce1e A T 3: 92,615,178 (GRCm39) C56* probably null Het
Lmcd1 T C 6: 112,264,832 (GRCm39) probably benign Het
Lrrc14 T A 15: 76,597,562 (GRCm39) probably null Het
Lypd8l A T 11: 58,503,338 (GRCm39) probably null Het
Map4k5 G A 12: 69,865,212 (GRCm39) P591L probably benign Het
Mapk13 C A 17: 28,995,284 (GRCm39) D168E probably damaging Het
Marf1 A C 16: 13,950,529 (GRCm39) H952Q possibly damaging Het
Megf6 T C 4: 154,338,738 (GRCm39) probably null Het
Mical3 T C 6: 121,010,748 (GRCm39) I411M probably damaging Het
Myo5a A T 9: 75,124,789 (GRCm39) K1781N probably damaging Het
N4bp2 T C 5: 65,965,473 (GRCm39) V1174A probably benign Het
Ncdn A T 4: 126,644,216 (GRCm39) L202Q probably damaging Het
Ncor1 T A 11: 62,283,464 (GRCm39) M408L possibly damaging Het
Nf1 T C 11: 79,300,235 (GRCm39) L249P probably damaging Het
Nlrp9b T A 7: 19,783,521 (GRCm39) probably null Het
Nxpe3 A T 16: 55,669,996 (GRCm39) Y370N probably damaging Het
P2rx2 T A 5: 110,489,434 (GRCm39) T167S probably benign Het
Pcdhb19 G T 18: 37,632,161 (GRCm39) R652L probably benign Het
Pcdhga12 T C 18: 37,901,334 (GRCm39) L722P probably benign Het
Pde6a A T 18: 61,378,663 (GRCm39) I329F probably damaging Het
Pdpr T A 8: 111,828,583 (GRCm39) S29T probably benign Het
Pfkfb3 T C 2: 11,491,123 (GRCm39) D173G probably benign Het
Plcd4 A G 1: 74,604,961 (GRCm39) probably null Het
Polr1g T A 7: 19,091,684 (GRCm39) Q141L probably damaging Het
Pou2f2 A G 7: 24,796,533 (GRCm39) probably benign Het
Ppp1r14c TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGG 10: 3,316,702 (GRCm39) probably benign Het
Ppp1r42 T C 1: 10,073,611 (GRCm39) probably benign Het
Ptpre C T 7: 135,270,861 (GRCm39) H346Y probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rab12 A T 17: 66,805,103 (GRCm39) Y142N probably damaging Het
Rai14 A C 15: 10,572,556 (GRCm39) M857R probably damaging Het
Ranbp2 A G 10: 58,328,243 (GRCm39) K2753R probably damaging Het
Rasa4 A T 5: 136,132,765 (GRCm39) K6* probably null Het
Rasgef1a A G 6: 118,066,100 (GRCm39) M438V probably benign Het
Recql T G 6: 142,304,732 (GRCm39) probably benign Het
Rftn2 A G 1: 55,211,198 (GRCm39) V425A probably benign Het
Ror1 A G 4: 100,267,001 (GRCm39) Y234C probably damaging Het
Sap30l T A 11: 57,696,880 (GRCm39) L70Q probably damaging Het
Scn4a T C 11: 106,210,828 (GRCm39) R1730G probably damaging Het
Serinc5 T G 13: 92,827,488 (GRCm39) I268R probably damaging Het
Sin3b G A 8: 73,471,576 (GRCm39) V432I possibly damaging Het
Slc30a6 T C 17: 74,719,649 (GRCm39) M203T possibly damaging Het
Soat1 T C 1: 156,259,898 (GRCm39) N481S probably damaging Het
Sos2 G A 12: 69,686,928 (GRCm39) T206I probably benign Het
Sp100 G T 1: 85,632,724 (GRCm39) A132S probably benign Het
Sp140l1 C T 1: 85,066,521 (GRCm39) probably benign Het
Spata31d1c T A 13: 65,183,604 (GRCm39) L382* probably null Het
Stard9 T A 2: 120,531,341 (GRCm39) W2533R probably benign Het
Tas2r126 A G 6: 42,412,324 (GRCm39) T286A probably benign Het
Tedc2 T A 17: 24,436,910 (GRCm39) K275M probably damaging Het
Ten1 A T 11: 116,109,057 (GRCm39) K242N probably benign Het
Thoc2l A T 5: 104,665,616 (GRCm39) D46V possibly damaging Het
Tial1 C T 7: 128,056,752 (GRCm39) V1I probably damaging Het
Tle2 G A 10: 81,424,725 (GRCm39) R649H possibly damaging Het
Tmem178 A G 17: 81,252,374 (GRCm39) D86G probably benign Het
Trim29 T A 9: 43,240,872 (GRCm39) D528E possibly damaging Het
Vmn2r61 A T 7: 41,950,132 (GRCm39) T851S probably benign Het
Vmn2r72 T A 7: 85,399,806 (GRCm39) Q414H possibly damaging Het
Yars1 A T 4: 129,083,675 (GRCm39) probably benign Het
Yipf4 A G 17: 74,801,087 (GRCm39) Q135R probably damaging Het
Zfp341 G A 2: 154,487,786 (GRCm39) probably benign Het
Zfp426 T C 9: 20,381,334 (GRCm39) Y536C probably damaging Het
Zp2 T G 7: 119,734,995 (GRCm39) Y430S probably damaging Het
Other mutations in Ei24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00862:Ei24 APN 9 36,695,774 (GRCm39) nonsense probably null
IGL00954:Ei24 APN 9 36,701,166 (GRCm39) missense probably damaging 0.96
IGL01336:Ei24 APN 9 36,697,777 (GRCm39) critical splice donor site probably null
IGL01940:Ei24 APN 9 36,693,687 (GRCm39) missense probably damaging 1.00
IGL02112:Ei24 APN 9 36,693,638 (GRCm39) missense probably damaging 0.99
IGL02328:Ei24 APN 9 36,696,827 (GRCm39) critical splice donor site probably null
IGL03251:Ei24 APN 9 36,691,405 (GRCm39) makesense probably null
PIT4378001:Ei24 UTSW 9 36,697,320 (GRCm39) missense probably damaging 1.00
R0673:Ei24 UTSW 9 36,699,551 (GRCm39) critical splice acceptor site probably null
R2047:Ei24 UTSW 9 36,691,459 (GRCm39) missense probably benign 0.03
R2280:Ei24 UTSW 9 36,693,635 (GRCm39) critical splice donor site probably null
R5125:Ei24 UTSW 9 36,693,742 (GRCm39) unclassified probably benign
R5999:Ei24 UTSW 9 36,704,603 (GRCm39) missense probably benign 0.06
R7515:Ei24 UTSW 9 36,701,211 (GRCm39) missense probably damaging 1.00
R8366:Ei24 UTSW 9 36,697,800 (GRCm39) missense possibly damaging 0.92
R8836:Ei24 UTSW 9 36,701,498 (GRCm39) missense
R9099:Ei24 UTSW 9 36,697,270 (GRCm39) missense probably damaging 1.00
R9156:Ei24 UTSW 9 36,697,327 (GRCm39) missense probably damaging 0.99
R9331:Ei24 UTSW 9 36,701,217 (GRCm39) missense possibly damaging 0.90
R9405:Ei24 UTSW 9 36,694,137 (GRCm39) missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GCTGAGTGCTTAAGTATTGAACAGC -3'
(R):5'- ACTGAGGCATGGGTTTCAGG -3'

Sequencing Primer
(F):5'- GAACAGCTTCGTCTGTATAGCAC -3'
(R):5'- GGCGTTTTTATCAGAATCAGCTAGAG -3'
Posted On 2016-03-17