Incidental Mutation 'R4863:Myo5a'
ID 374670
Institutional Source Beutler Lab
Gene Symbol Myo5a
Ensembl Gene ENSMUSG00000034593
Gene Name myosin VA
Synonyms flail, Myo5, MVa, Dbv, 9630007J19Rik, MyoVA
MMRRC Submission 042473-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.961) question?
Stock # R4863 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 74978297-75130970 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 75124789 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 1781 (K1781N)
Ref Sequence ENSEMBL: ENSMUSP00000117493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000136731] [ENSMUST00000148144] [ENSMUST00000155282]
AlphaFold Q99104
Predicted Effect probably damaging
Transcript: ENSMUST00000123128
AA Change: K1779N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: K1779N

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1364 N/A INTRINSIC
coiled coil region 1406 1443 N/A INTRINSIC
DIL 1685 1790 2.47e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136604
Predicted Effect probably damaging
Transcript: ENSMUST00000136731
AA Change: K1754N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: K1754N

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1418 N/A INTRINSIC
DIL 1660 1765 2.47e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148144
AA Change: K511N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121158
Gene: ENSMUSG00000034593
AA Change: K511N

DomainStartEndE-ValueType
coiled coil region 71 175 N/A INTRINSIC
Blast:DIL 275 305 4e-13 BLAST
Blast:DIL 330 355 5e-6 BLAST
DIL 417 522 2.47e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000155282
AA Change: K1781N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: K1781N

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1339 1445 N/A INTRINSIC
DIL 1687 1792 2.47e-51 SMART
Meta Mutation Damage Score 0.2044 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (105/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 64,210,658 (GRCm39) R190H probably benign Het
Abcc12 T A 8: 87,265,005 (GRCm39) I647F probably damaging Het
Acnat2 C A 4: 49,380,172 (GRCm39) W384L probably damaging Het
Acvr1 A G 2: 58,367,723 (GRCm39) L146P possibly damaging Het
Ankrd16 T A 2: 11,789,127 (GRCm39) M238K probably benign Het
Clmn A T 12: 104,763,353 (GRCm39) I91N probably damaging Het
Cog8 A T 8: 107,776,806 (GRCm39) L523H probably damaging Het
Cpxm2 T A 7: 131,661,476 (GRCm39) K437M probably benign Het
Dhx57 A T 17: 80,560,540 (GRCm39) V999E probably damaging Het
Dnpep T C 1: 75,285,874 (GRCm39) probably benign Het
Dok3 G A 13: 55,671,270 (GRCm39) R434W probably damaging Het
Dpysl5 C T 5: 30,941,687 (GRCm39) H275Y probably benign Het
Ednra A T 8: 78,394,012 (GRCm39) N361K probably damaging Het
Ei24 A T 9: 36,695,861 (GRCm39) S210R probably damaging Het
Erich3 T A 3: 154,470,441 (GRCm39) V158E unknown Het
Fam193a T A 5: 34,623,549 (GRCm39) V1379E possibly damaging Het
Fasn A G 11: 120,699,654 (GRCm39) V2304A probably damaging Het
Fcgbp A C 7: 27,785,769 (GRCm39) D402A probably benign Het
Fkbp14 T C 6: 54,562,930 (GRCm39) probably benign Het
Fnip1 G A 11: 54,406,382 (GRCm39) V1160I possibly damaging Het
Fsd2 T C 7: 81,202,712 (GRCm39) K289R probably null Het
Fuca2 A T 10: 13,381,651 (GRCm39) D188V probably damaging Het
Gfpt2 T C 11: 49,701,797 (GRCm39) V116A probably benign Het
Gm10770 T A 2: 150,020,816 (GRCm39) K234* probably null Het
Gm9887 A G 12: 69,418,763 (GRCm39) probably benign Het
Gtf3c2 A G 5: 31,316,577 (GRCm39) probably benign Het
H2-M10.3 T C 17: 36,677,528 (GRCm39) D250G probably damaging Het
Hapln4 G A 8: 70,537,142 (GRCm39) V26M possibly damaging Het
Hook3 G A 8: 26,528,057 (GRCm39) A611V probably damaging Het
Hr T C 14: 70,809,412 (GRCm39) L1141P probably damaging Het
Ifngr1 T C 10: 19,485,164 (GRCm39) S388P probably damaging Het
Itga3 T A 11: 94,952,793 (GRCm39) Q326L probably damaging Het
Itgb3 T A 11: 104,556,346 (GRCm39) I729N probably damaging Het
Kcnab2 A G 4: 152,486,403 (GRCm39) S132P probably damaging Het
Lama3 C T 18: 12,672,850 (GRCm39) A2481V probably damaging Het
Lama3 T C 18: 12,631,735 (GRCm39) probably benign Het
Lce1e A T 3: 92,615,178 (GRCm39) C56* probably null Het
Lmcd1 T C 6: 112,264,832 (GRCm39) probably benign Het
Lrrc14 T A 15: 76,597,562 (GRCm39) probably null Het
Lypd8l A T 11: 58,503,338 (GRCm39) probably null Het
Map4k5 G A 12: 69,865,212 (GRCm39) P591L probably benign Het
Mapk13 C A 17: 28,995,284 (GRCm39) D168E probably damaging Het
Marf1 A C 16: 13,950,529 (GRCm39) H952Q possibly damaging Het
Megf6 T C 4: 154,338,738 (GRCm39) probably null Het
Mical3 T C 6: 121,010,748 (GRCm39) I411M probably damaging Het
N4bp2 T C 5: 65,965,473 (GRCm39) V1174A probably benign Het
Ncdn A T 4: 126,644,216 (GRCm39) L202Q probably damaging Het
Ncor1 T A 11: 62,283,464 (GRCm39) M408L possibly damaging Het
Nf1 T C 11: 79,300,235 (GRCm39) L249P probably damaging Het
Nlrp9b T A 7: 19,783,521 (GRCm39) probably null Het
Nxpe3 A T 16: 55,669,996 (GRCm39) Y370N probably damaging Het
P2rx2 T A 5: 110,489,434 (GRCm39) T167S probably benign Het
Pcdhb19 G T 18: 37,632,161 (GRCm39) R652L probably benign Het
Pcdhga12 T C 18: 37,901,334 (GRCm39) L722P probably benign Het
Pde6a A T 18: 61,378,663 (GRCm39) I329F probably damaging Het
Pdpr T A 8: 111,828,583 (GRCm39) S29T probably benign Het
Pfkfb3 T C 2: 11,491,123 (GRCm39) D173G probably benign Het
Plcd4 A G 1: 74,604,961 (GRCm39) probably null Het
Polr1g T A 7: 19,091,684 (GRCm39) Q141L probably damaging Het
Pou2f2 A G 7: 24,796,533 (GRCm39) probably benign Het
Ppp1r14c TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGG 10: 3,316,702 (GRCm39) probably benign Het
Ppp1r42 T C 1: 10,073,611 (GRCm39) probably benign Het
Ptpre C T 7: 135,270,861 (GRCm39) H346Y probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rab12 A T 17: 66,805,103 (GRCm39) Y142N probably damaging Het
Rai14 A C 15: 10,572,556 (GRCm39) M857R probably damaging Het
Ranbp2 A G 10: 58,328,243 (GRCm39) K2753R probably damaging Het
Rasa4 A T 5: 136,132,765 (GRCm39) K6* probably null Het
Rasgef1a A G 6: 118,066,100 (GRCm39) M438V probably benign Het
Recql T G 6: 142,304,732 (GRCm39) probably benign Het
Rftn2 A G 1: 55,211,198 (GRCm39) V425A probably benign Het
Ror1 A G 4: 100,267,001 (GRCm39) Y234C probably damaging Het
Sap30l T A 11: 57,696,880 (GRCm39) L70Q probably damaging Het
Scn4a T C 11: 106,210,828 (GRCm39) R1730G probably damaging Het
Serinc5 T G 13: 92,827,488 (GRCm39) I268R probably damaging Het
Sin3b G A 8: 73,471,576 (GRCm39) V432I possibly damaging Het
Slc30a6 T C 17: 74,719,649 (GRCm39) M203T possibly damaging Het
Soat1 T C 1: 156,259,898 (GRCm39) N481S probably damaging Het
Sos2 G A 12: 69,686,928 (GRCm39) T206I probably benign Het
Sp100 G T 1: 85,632,724 (GRCm39) A132S probably benign Het
Sp140l1 C T 1: 85,066,521 (GRCm39) probably benign Het
Spata31d1c T A 13: 65,183,604 (GRCm39) L382* probably null Het
Stard9 T A 2: 120,531,341 (GRCm39) W2533R probably benign Het
Tas2r126 A G 6: 42,412,324 (GRCm39) T286A probably benign Het
Tedc2 T A 17: 24,436,910 (GRCm39) K275M probably damaging Het
Ten1 A T 11: 116,109,057 (GRCm39) K242N probably benign Het
Thoc2l A T 5: 104,665,616 (GRCm39) D46V possibly damaging Het
Tial1 C T 7: 128,056,752 (GRCm39) V1I probably damaging Het
Tle2 G A 10: 81,424,725 (GRCm39) R649H possibly damaging Het
Tmem178 A G 17: 81,252,374 (GRCm39) D86G probably benign Het
Trim29 T A 9: 43,240,872 (GRCm39) D528E possibly damaging Het
Vmn2r61 A T 7: 41,950,132 (GRCm39) T851S probably benign Het
Vmn2r72 T A 7: 85,399,806 (GRCm39) Q414H possibly damaging Het
Yars1 A T 4: 129,083,675 (GRCm39) probably benign Het
Yipf4 A G 17: 74,801,087 (GRCm39) Q135R probably damaging Het
Zfp341 G A 2: 154,487,786 (GRCm39) probably benign Het
Zfp426 T C 9: 20,381,334 (GRCm39) Y536C probably damaging Het
Zp2 T G 7: 119,734,995 (GRCm39) Y430S probably damaging Het
Other mutations in Myo5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Myo5a APN 9 75,068,779 (GRCm39) nonsense probably null
IGL00547:Myo5a APN 9 75,048,735 (GRCm39) missense probably benign 0.00
IGL00788:Myo5a APN 9 75,076,241 (GRCm39) missense probably benign 0.15
IGL01327:Myo5a APN 9 75,094,820 (GRCm39) splice site probably benign
IGL01687:Myo5a APN 9 75,063,531 (GRCm39) missense probably benign 0.12
IGL01886:Myo5a APN 9 75,076,372 (GRCm39) splice site probably benign
IGL01945:Myo5a APN 9 75,047,953 (GRCm39) missense probably damaging 1.00
IGL02127:Myo5a APN 9 75,120,263 (GRCm39) missense probably benign 0.12
IGL02137:Myo5a APN 9 75,068,817 (GRCm39) splice site probably null
IGL02183:Myo5a APN 9 75,074,518 (GRCm39) splice site probably benign
IGL02427:Myo5a APN 9 75,083,900 (GRCm39) splice site probably benign
IGL02490:Myo5a APN 9 75,043,737 (GRCm39) missense probably damaging 1.00
IGL02574:Myo5a APN 9 75,118,429 (GRCm39) missense probably benign 0.00
IGL02886:Myo5a APN 9 75,059,169 (GRCm39) splice site probably benign
IGL02961:Myo5a APN 9 75,122,402 (GRCm39) missense probably benign 0.04
IGL03090:Myo5a APN 9 75,028,115 (GRCm39) missense probably damaging 1.00
IGL03119:Myo5a APN 9 75,081,297 (GRCm39) missense probably benign 0.01
IGL03237:Myo5a APN 9 75,037,276 (GRCm39) missense probably damaging 1.00
IGL03296:Myo5a APN 9 75,023,484 (GRCm39) missense probably damaging 1.00
naoki UTSW 9 75,068,774 (GRCm39) missense probably damaging 1.00
new_gray UTSW 9 0 () missense
nut UTSW 9 0 () splice donor site
silver_decerebrate UTSW 9 75,071,477 (GRCm39) missense probably damaging 1.00
silver_decerebrate_2 UTSW 9 75,118,408 (GRCm39) missense probably damaging 1.00
IGL02988:Myo5a UTSW 9 75,037,423 (GRCm39) splice site probably benign
IGL03050:Myo5a UTSW 9 75,054,191 (GRCm39) splice site probably null
PIT4403001:Myo5a UTSW 9 75,124,805 (GRCm39) missense probably damaging 1.00
R0047:Myo5a UTSW 9 75,063,489 (GRCm39) missense probably damaging 1.00
R0047:Myo5a UTSW 9 75,063,489 (GRCm39) missense probably damaging 1.00
R0091:Myo5a UTSW 9 75,068,774 (GRCm39) missense probably damaging 1.00
R0142:Myo5a UTSW 9 75,067,856 (GRCm39) missense probably benign 0.01
R0243:Myo5a UTSW 9 75,093,405 (GRCm39) critical splice donor site probably null
R0395:Myo5a UTSW 9 75,101,259 (GRCm39) missense probably benign 0.39
R0427:Myo5a UTSW 9 75,081,478 (GRCm39) missense probably benign 0.00
R0545:Myo5a UTSW 9 75,074,319 (GRCm39) missense possibly damaging 0.94
R0565:Myo5a UTSW 9 75,087,394 (GRCm39) missense probably benign 0.00
R0601:Myo5a UTSW 9 75,081,297 (GRCm39) missense probably benign 0.01
R1457:Myo5a UTSW 9 75,120,347 (GRCm39) missense probably damaging 0.99
R1510:Myo5a UTSW 9 75,078,833 (GRCm39) missense probably benign
R1548:Myo5a UTSW 9 75,079,028 (GRCm39) missense probably damaging 1.00
R1759:Myo5a UTSW 9 75,089,275 (GRCm39) missense possibly damaging 0.72
R1924:Myo5a UTSW 9 75,023,489 (GRCm39) missense probably damaging 1.00
R1960:Myo5a UTSW 9 75,055,139 (GRCm39) missense probably damaging 1.00
R2050:Myo5a UTSW 9 75,054,156 (GRCm39) missense probably benign 0.01
R2070:Myo5a UTSW 9 75,089,266 (GRCm39) missense probably benign 0.03
R2075:Myo5a UTSW 9 75,097,200 (GRCm39) missense probably benign 0.01
R2148:Myo5a UTSW 9 75,087,429 (GRCm39) missense probably damaging 1.00
R2201:Myo5a UTSW 9 75,125,225 (GRCm39) missense possibly damaging 0.51
R2337:Myo5a UTSW 9 75,111,083 (GRCm39) missense probably damaging 1.00
R2357:Myo5a UTSW 9 75,108,647 (GRCm39) missense probably damaging 0.99
R2392:Myo5a UTSW 9 75,116,521 (GRCm39) missense probably benign 0.02
R2432:Myo5a UTSW 9 75,120,155 (GRCm39) missense possibly damaging 0.89
R2568:Myo5a UTSW 9 75,059,179 (GRCm39) missense probably damaging 1.00
R2568:Myo5a UTSW 9 75,030,322 (GRCm39) missense probably damaging 1.00
R2932:Myo5a UTSW 9 75,103,418 (GRCm39) missense possibly damaging 0.85
R2971:Myo5a UTSW 9 75,023,484 (GRCm39) missense probably damaging 1.00
R4231:Myo5a UTSW 9 75,097,279 (GRCm39) missense possibly damaging 0.67
R4293:Myo5a UTSW 9 75,051,453 (GRCm39) missense probably benign
R4321:Myo5a UTSW 9 75,124,812 (GRCm39) missense probably damaging 0.99
R4450:Myo5a UTSW 9 75,074,458 (GRCm39) missense probably benign 0.00
R4573:Myo5a UTSW 9 75,108,579 (GRCm39) splice site probably null
R4577:Myo5a UTSW 9 75,124,827 (GRCm39) missense probably damaging 1.00
R4601:Myo5a UTSW 9 75,043,670 (GRCm39) missense probably damaging 1.00
R4690:Myo5a UTSW 9 75,061,105 (GRCm39) missense probably damaging 0.99
R4691:Myo5a UTSW 9 75,087,438 (GRCm39) missense probably damaging 0.99
R4764:Myo5a UTSW 9 75,023,618 (GRCm39) intron probably benign
R4767:Myo5a UTSW 9 75,051,358 (GRCm39) missense probably damaging 0.99
R4811:Myo5a UTSW 9 75,048,825 (GRCm39) critical splice donor site probably null
R4829:Myo5a UTSW 9 75,043,689 (GRCm39) missense probably damaging 1.00
R4902:Myo5a UTSW 9 75,081,360 (GRCm39) missense probably benign
R4947:Myo5a UTSW 9 75,030,330 (GRCm39) missense probably damaging 1.00
R5074:Myo5a UTSW 9 75,081,438 (GRCm39) missense probably benign
R5095:Myo5a UTSW 9 75,091,671 (GRCm39) nonsense probably null
R5095:Myo5a UTSW 9 75,059,302 (GRCm39) missense probably damaging 1.00
R5254:Myo5a UTSW 9 75,037,402 (GRCm39) missense probably damaging 1.00
R5267:Myo5a UTSW 9 75,059,292 (GRCm39) missense probably damaging 1.00
R5419:Myo5a UTSW 9 75,055,179 (GRCm39) missense probably damaging 1.00
R5514:Myo5a UTSW 9 75,061,048 (GRCm39) missense probably damaging 1.00
R5629:Myo5a UTSW 9 75,111,127 (GRCm39) missense possibly damaging 0.89
R5649:Myo5a UTSW 9 75,079,001 (GRCm39) missense possibly damaging 0.92
R5661:Myo5a UTSW 9 75,074,488 (GRCm39) missense probably benign 0.02
R5665:Myo5a UTSW 9 75,051,463 (GRCm39) critical splice donor site probably null
R5719:Myo5a UTSW 9 75,059,213 (GRCm39) missense probably damaging 1.00
R5964:Myo5a UTSW 9 75,111,115 (GRCm39) missense probably benign 0.09
R6014:Myo5a UTSW 9 75,074,489 (GRCm39) nonsense probably null
R6344:Myo5a UTSW 9 75,067,791 (GRCm39) missense probably benign 0.09
R6345:Myo5a UTSW 9 75,097,195 (GRCm39) missense possibly damaging 0.77
R6644:Myo5a UTSW 9 75,054,249 (GRCm39) missense probably damaging 0.98
R6712:Myo5a UTSW 9 75,120,182 (GRCm39) missense probably benign 0.12
R6838:Myo5a UTSW 9 75,061,165 (GRCm39) critical splice donor site probably null
R6866:Myo5a UTSW 9 75,047,970 (GRCm39) missense probably damaging 1.00
R6876:Myo5a UTSW 9 75,067,772 (GRCm39) missense probably benign 0.04
R7108:Myo5a UTSW 9 75,037,274 (GRCm39) missense probably damaging 1.00
R7159:Myo5a UTSW 9 75,078,845 (GRCm39) missense probably benign 0.07
R7164:Myo5a UTSW 9 75,087,435 (GRCm39) missense probably benign 0.00
R7219:Myo5a UTSW 9 75,028,052 (GRCm39) missense probably damaging 1.00
R7497:Myo5a UTSW 9 75,104,983 (GRCm39) missense
R7620:Myo5a UTSW 9 75,071,418 (GRCm39) missense probably benign 0.41
R7719:Myo5a UTSW 9 75,051,366 (GRCm39) missense probably benign 0.01
R7810:Myo5a UTSW 9 75,076,292 (GRCm39) missense probably benign
R7810:Myo5a UTSW 9 75,067,747 (GRCm39) missense probably benign 0.09
R7866:Myo5a UTSW 9 75,111,034 (GRCm39) missense probably damaging 1.00
R7939:Myo5a UTSW 9 75,097,182 (GRCm39) missense
R8050:Myo5a UTSW 9 75,089,228 (GRCm39) missense probably damaging 0.99
R8061:Myo5a UTSW 9 75,030,239 (GRCm39) nonsense probably null
R8326:Myo5a UTSW 9 75,125,271 (GRCm39) missense probably damaging 0.98
R8529:Myo5a UTSW 9 75,120,154 (GRCm39) missense probably benign 0.02
R8824:Myo5a UTSW 9 75,074,328 (GRCm39) missense probably damaging 1.00
R8858:Myo5a UTSW 9 75,091,965 (GRCm39) missense probably damaging 0.99
R9040:Myo5a UTSW 9 75,081,341 (GRCm39) missense probably benign 0.07
R9092:Myo5a UTSW 9 75,054,414 (GRCm39) critical splice donor site probably null
R9249:Myo5a UTSW 9 75,097,279 (GRCm39) missense possibly damaging 0.67
R9274:Myo5a UTSW 9 75,097,279 (GRCm39) missense possibly damaging 0.67
R9293:Myo5a UTSW 9 75,087,312 (GRCm39) missense probably benign 0.37
R9366:Myo5a UTSW 9 75,124,800 (GRCm39) missense probably damaging 0.98
R9410:Myo5a UTSW 9 75,023,496 (GRCm39) missense probably damaging 0.98
R9644:Myo5a UTSW 9 75,043,631 (GRCm39) missense probably damaging 1.00
R9649:Myo5a UTSW 9 75,099,726 (GRCm39) missense
R9748:Myo5a UTSW 9 75,091,965 (GRCm39) missense probably damaging 0.99
R9766:Myo5a UTSW 9 75,078,914 (GRCm39) missense probably damaging 0.99
X0010:Myo5a UTSW 9 75,093,187 (GRCm39) missense probably damaging 1.00
Z1177:Myo5a UTSW 9 75,093,318 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AAATAGGGGCACTTTTCCCC -3'
(R):5'- GTATCAATCCTTCCAACTTGCAAG -3'

Sequencing Primer
(F):5'- GGCACTTTTCCCCGAGTTATATTTTG -3'
(R):5'- CCTTCCAACTTGCAAGATATTTTTC -3'
Posted On 2016-03-17