Incidental Mutation 'R4863:Fnip1'
ID 374677
Institutional Source Beutler Lab
Gene Symbol Fnip1
Ensembl Gene ENSMUSG00000035992
Gene Name folliculin interacting protein 1
Synonyms A730024A03Rik
MMRRC Submission 042473-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.793) question?
Stock # R4863 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 54329025-54409061 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 54406382 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 1160 (V1160I)
Ref Sequence ENSEMBL: ENSMUSP00000049026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046835]
AlphaFold Q68FD7
Predicted Effect possibly damaging
Transcript: ENSMUST00000046835
AA Change: V1160I

PolyPhen 2 Score 0.521 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049026
Gene: ENSMUSG00000035992
AA Change: V1160I

DomainStartEndE-ValueType
Pfam:FNIP_N 41 159 1.7e-29 PFAM
Pfam:FNIP_M 316 549 9.9e-92 PFAM
Pfam:FNIP_C 975 1161 7.6e-73 PFAM
Meta Mutation Damage Score 0.1769 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (105/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the folliculin-interacting protein family. The encoded protein binds to the tumor suppressor folliculin and to AMP-activated protein kinase (AMPK) and be involved in cellular metabolism and nutrient sensing by regulating the AMPK-mechanistic target of rapamycin signaling pathway. A homologous binding partner of this protein, folliculin-interacting protein 2, has similar binding activities and may suggest functional redundancy within this protein family. Both folliculin-interacting proteins have also been shown to bind the molecular chaperone heat shock protein-90 (Hsp90) and they may function as a co-chaperones in the stabilization of tumor suppressor folliculin which is a target of Hsp90 chaperone activity. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced or targeted allele exhibit arrested B cell development at the pre-B cell stage with increased B cell apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(1) Gene trapped(2)

Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 64,210,658 (GRCm39) R190H probably benign Het
Abcc12 T A 8: 87,265,005 (GRCm39) I647F probably damaging Het
Acnat2 C A 4: 49,380,172 (GRCm39) W384L probably damaging Het
Acvr1 A G 2: 58,367,723 (GRCm39) L146P possibly damaging Het
Ankrd16 T A 2: 11,789,127 (GRCm39) M238K probably benign Het
Clmn A T 12: 104,763,353 (GRCm39) I91N probably damaging Het
Cog8 A T 8: 107,776,806 (GRCm39) L523H probably damaging Het
Cpxm2 T A 7: 131,661,476 (GRCm39) K437M probably benign Het
Dhx57 A T 17: 80,560,540 (GRCm39) V999E probably damaging Het
Dnpep T C 1: 75,285,874 (GRCm39) probably benign Het
Dok3 G A 13: 55,671,270 (GRCm39) R434W probably damaging Het
Dpysl5 C T 5: 30,941,687 (GRCm39) H275Y probably benign Het
Ednra A T 8: 78,394,012 (GRCm39) N361K probably damaging Het
Ei24 A T 9: 36,695,861 (GRCm39) S210R probably damaging Het
Erich3 T A 3: 154,470,441 (GRCm39) V158E unknown Het
Fam193a T A 5: 34,623,549 (GRCm39) V1379E possibly damaging Het
Fasn A G 11: 120,699,654 (GRCm39) V2304A probably damaging Het
Fcgbp A C 7: 27,785,769 (GRCm39) D402A probably benign Het
Fkbp14 T C 6: 54,562,930 (GRCm39) probably benign Het
Fsd2 T C 7: 81,202,712 (GRCm39) K289R probably null Het
Fuca2 A T 10: 13,381,651 (GRCm39) D188V probably damaging Het
Gfpt2 T C 11: 49,701,797 (GRCm39) V116A probably benign Het
Gm10770 T A 2: 150,020,816 (GRCm39) K234* probably null Het
Gm9887 A G 12: 69,418,763 (GRCm39) probably benign Het
Gtf3c2 A G 5: 31,316,577 (GRCm39) probably benign Het
H2-M10.3 T C 17: 36,677,528 (GRCm39) D250G probably damaging Het
Hapln4 G A 8: 70,537,142 (GRCm39) V26M possibly damaging Het
Hook3 G A 8: 26,528,057 (GRCm39) A611V probably damaging Het
Hr T C 14: 70,809,412 (GRCm39) L1141P probably damaging Het
Ifngr1 T C 10: 19,485,164 (GRCm39) S388P probably damaging Het
Itga3 T A 11: 94,952,793 (GRCm39) Q326L probably damaging Het
Itgb3 T A 11: 104,556,346 (GRCm39) I729N probably damaging Het
Kcnab2 A G 4: 152,486,403 (GRCm39) S132P probably damaging Het
Lama3 C T 18: 12,672,850 (GRCm39) A2481V probably damaging Het
Lama3 T C 18: 12,631,735 (GRCm39) probably benign Het
Lce1e A T 3: 92,615,178 (GRCm39) C56* probably null Het
Lmcd1 T C 6: 112,264,832 (GRCm39) probably benign Het
Lrrc14 T A 15: 76,597,562 (GRCm39) probably null Het
Lypd8l A T 11: 58,503,338 (GRCm39) probably null Het
Map4k5 G A 12: 69,865,212 (GRCm39) P591L probably benign Het
Mapk13 C A 17: 28,995,284 (GRCm39) D168E probably damaging Het
Marf1 A C 16: 13,950,529 (GRCm39) H952Q possibly damaging Het
Megf6 T C 4: 154,338,738 (GRCm39) probably null Het
Mical3 T C 6: 121,010,748 (GRCm39) I411M probably damaging Het
Myo5a A T 9: 75,124,789 (GRCm39) K1781N probably damaging Het
N4bp2 T C 5: 65,965,473 (GRCm39) V1174A probably benign Het
Ncdn A T 4: 126,644,216 (GRCm39) L202Q probably damaging Het
Ncor1 T A 11: 62,283,464 (GRCm39) M408L possibly damaging Het
Nf1 T C 11: 79,300,235 (GRCm39) L249P probably damaging Het
Nlrp9b T A 7: 19,783,521 (GRCm39) probably null Het
Nxpe3 A T 16: 55,669,996 (GRCm39) Y370N probably damaging Het
P2rx2 T A 5: 110,489,434 (GRCm39) T167S probably benign Het
Pcdhb19 G T 18: 37,632,161 (GRCm39) R652L probably benign Het
Pcdhga12 T C 18: 37,901,334 (GRCm39) L722P probably benign Het
Pde6a A T 18: 61,378,663 (GRCm39) I329F probably damaging Het
Pdpr T A 8: 111,828,583 (GRCm39) S29T probably benign Het
Pfkfb3 T C 2: 11,491,123 (GRCm39) D173G probably benign Het
Plcd4 A G 1: 74,604,961 (GRCm39) probably null Het
Polr1g T A 7: 19,091,684 (GRCm39) Q141L probably damaging Het
Pou2f2 A G 7: 24,796,533 (GRCm39) probably benign Het
Ppp1r14c TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGG 10: 3,316,702 (GRCm39) probably benign Het
Ppp1r42 T C 1: 10,073,611 (GRCm39) probably benign Het
Ptpre C T 7: 135,270,861 (GRCm39) H346Y probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rab12 A T 17: 66,805,103 (GRCm39) Y142N probably damaging Het
Rai14 A C 15: 10,572,556 (GRCm39) M857R probably damaging Het
Ranbp2 A G 10: 58,328,243 (GRCm39) K2753R probably damaging Het
Rasa4 A T 5: 136,132,765 (GRCm39) K6* probably null Het
Rasgef1a A G 6: 118,066,100 (GRCm39) M438V probably benign Het
Recql T G 6: 142,304,732 (GRCm39) probably benign Het
Rftn2 A G 1: 55,211,198 (GRCm39) V425A probably benign Het
Ror1 A G 4: 100,267,001 (GRCm39) Y234C probably damaging Het
Sap30l T A 11: 57,696,880 (GRCm39) L70Q probably damaging Het
Scn4a T C 11: 106,210,828 (GRCm39) R1730G probably damaging Het
Serinc5 T G 13: 92,827,488 (GRCm39) I268R probably damaging Het
Sin3b G A 8: 73,471,576 (GRCm39) V432I possibly damaging Het
Slc30a6 T C 17: 74,719,649 (GRCm39) M203T possibly damaging Het
Soat1 T C 1: 156,259,898 (GRCm39) N481S probably damaging Het
Sos2 G A 12: 69,686,928 (GRCm39) T206I probably benign Het
Sp100 G T 1: 85,632,724 (GRCm39) A132S probably benign Het
Sp140l1 C T 1: 85,066,521 (GRCm39) probably benign Het
Spata31d1c T A 13: 65,183,604 (GRCm39) L382* probably null Het
Stard9 T A 2: 120,531,341 (GRCm39) W2533R probably benign Het
Tas2r126 A G 6: 42,412,324 (GRCm39) T286A probably benign Het
Tedc2 T A 17: 24,436,910 (GRCm39) K275M probably damaging Het
Ten1 A T 11: 116,109,057 (GRCm39) K242N probably benign Het
Thoc2l A T 5: 104,665,616 (GRCm39) D46V possibly damaging Het
Tial1 C T 7: 128,056,752 (GRCm39) V1I probably damaging Het
Tle2 G A 10: 81,424,725 (GRCm39) R649H possibly damaging Het
Tmem178 A G 17: 81,252,374 (GRCm39) D86G probably benign Het
Trim29 T A 9: 43,240,872 (GRCm39) D528E possibly damaging Het
Vmn2r61 A T 7: 41,950,132 (GRCm39) T851S probably benign Het
Vmn2r72 T A 7: 85,399,806 (GRCm39) Q414H possibly damaging Het
Yars1 A T 4: 129,083,675 (GRCm39) probably benign Het
Yipf4 A G 17: 74,801,087 (GRCm39) Q135R probably damaging Het
Zfp341 G A 2: 154,487,786 (GRCm39) probably benign Het
Zfp426 T C 9: 20,381,334 (GRCm39) Y536C probably damaging Het
Zp2 T G 7: 119,734,995 (GRCm39) Y430S probably damaging Het
Other mutations in Fnip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Fnip1 APN 11 54,390,334 (GRCm39) missense probably damaging 1.00
IGL01590:Fnip1 APN 11 54,384,126 (GRCm39) missense probably damaging 1.00
IGL01959:Fnip1 APN 11 54,381,738 (GRCm39) missense possibly damaging 0.95
IGL02157:Fnip1 APN 11 54,378,589 (GRCm39) missense probably damaging 1.00
IGL02197:Fnip1 APN 11 54,384,200 (GRCm39) missense probably damaging 1.00
IGL02476:Fnip1 APN 11 54,390,393 (GRCm39) splice site probably benign
IGL02639:Fnip1 APN 11 54,366,466 (GRCm39) nonsense probably null
IGL02742:Fnip1 APN 11 54,384,177 (GRCm39) missense probably damaging 1.00
hamel UTSW 11 54,371,511 (GRCm39) critical splice donor site probably benign
hamel2 UTSW 11 54,393,097 (GRCm39) missense probably damaging 1.00
Normandy UTSW 11 54,384,007 (GRCm39) splice site probably benign
H8562:Fnip1 UTSW 11 54,371,123 (GRCm39) missense probably damaging 0.98
P0043:Fnip1 UTSW 11 54,394,051 (GRCm39) missense probably benign 0.00
R0114:Fnip1 UTSW 11 54,378,627 (GRCm39) splice site probably benign
R0278:Fnip1 UTSW 11 54,380,169 (GRCm39) splice site probably null
R0409:Fnip1 UTSW 11 54,371,180 (GRCm39) splice site probably null
R0840:Fnip1 UTSW 11 54,384,007 (GRCm39) splice site probably benign
R1131:Fnip1 UTSW 11 54,384,129 (GRCm39) missense possibly damaging 0.82
R1205:Fnip1 UTSW 11 54,393,132 (GRCm39) missense possibly damaging 0.91
R1271:Fnip1 UTSW 11 54,394,123 (GRCm39) missense probably benign
R1817:Fnip1 UTSW 11 54,393,279 (GRCm39) missense probably benign 0.30
R1826:Fnip1 UTSW 11 54,356,990 (GRCm39) missense probably damaging 1.00
R1872:Fnip1 UTSW 11 54,378,561 (GRCm39) missense probably damaging 1.00
R1883:Fnip1 UTSW 11 54,406,373 (GRCm39) missense probably damaging 1.00
R1917:Fnip1 UTSW 11 54,371,510 (GRCm39) missense probably damaging 0.99
R1918:Fnip1 UTSW 11 54,371,510 (GRCm39) missense probably damaging 0.99
R1919:Fnip1 UTSW 11 54,371,510 (GRCm39) missense probably damaging 0.99
R2010:Fnip1 UTSW 11 54,373,329 (GRCm39) missense probably damaging 1.00
R2117:Fnip1 UTSW 11 54,391,450 (GRCm39) missense probably damaging 1.00
R2329:Fnip1 UTSW 11 54,356,933 (GRCm39) missense probably damaging 0.98
R2337:Fnip1 UTSW 11 54,366,563 (GRCm39) missense probably damaging 0.98
R2850:Fnip1 UTSW 11 54,393,503 (GRCm39) missense probably benign 0.32
R2863:Fnip1 UTSW 11 54,393,250 (GRCm39) missense probably damaging 1.00
R2864:Fnip1 UTSW 11 54,393,250 (GRCm39) missense probably damaging 1.00
R2865:Fnip1 UTSW 11 54,393,250 (GRCm39) missense probably damaging 1.00
R3936:Fnip1 UTSW 11 54,371,065 (GRCm39) splice site probably null
R4017:Fnip1 UTSW 11 54,400,813 (GRCm39) missense probably benign 0.14
R4033:Fnip1 UTSW 11 54,393,297 (GRCm39) missense probably benign 0.02
R4668:Fnip1 UTSW 11 54,394,385 (GRCm39) missense probably damaging 1.00
R4695:Fnip1 UTSW 11 54,390,245 (GRCm39) missense probably damaging 1.00
R4762:Fnip1 UTSW 11 54,390,352 (GRCm39) missense probably benign 0.01
R4762:Fnip1 UTSW 11 54,356,997 (GRCm39) missense probably damaging 1.00
R4777:Fnip1 UTSW 11 54,391,382 (GRCm39) missense probably damaging 1.00
R5369:Fnip1 UTSW 11 54,393,415 (GRCm39) missense probably benign
R5481:Fnip1 UTSW 11 54,393,470 (GRCm39) missense probably benign 0.01
R5562:Fnip1 UTSW 11 54,380,168 (GRCm39) critical splice donor site probably null
R5563:Fnip1 UTSW 11 54,395,688 (GRCm39) missense probably benign 0.05
R5628:Fnip1 UTSW 11 54,394,459 (GRCm39) missense probably benign 0.08
R5689:Fnip1 UTSW 11 54,393,115 (GRCm39) missense probably damaging 1.00
R6009:Fnip1 UTSW 11 54,393,097 (GRCm39) missense probably damaging 1.00
R6120:Fnip1 UTSW 11 54,400,826 (GRCm39) missense probably benign 0.23
R6429:Fnip1 UTSW 11 54,406,393 (GRCm39) missense probably damaging 1.00
R6546:Fnip1 UTSW 11 54,393,437 (GRCm39) missense probably benign 0.03
R6600:Fnip1 UTSW 11 54,393,925 (GRCm39) missense probably benign
R6882:Fnip1 UTSW 11 54,400,724 (GRCm39) missense probably damaging 1.00
R6966:Fnip1 UTSW 11 54,373,385 (GRCm39) missense probably benign 0.00
R7009:Fnip1 UTSW 11 54,393,761 (GRCm39) missense probably damaging 1.00
R7664:Fnip1 UTSW 11 54,356,951 (GRCm39) missense probably damaging 1.00
R7706:Fnip1 UTSW 11 54,406,325 (GRCm39) missense probably benign 0.41
R7866:Fnip1 UTSW 11 54,356,228 (GRCm39) start gained probably benign
R7939:Fnip1 UTSW 11 54,393,093 (GRCm39) missense probably damaging 1.00
R7943:Fnip1 UTSW 11 54,393,214 (GRCm39) missense probably damaging 1.00
R8429:Fnip1 UTSW 11 54,366,522 (GRCm39) missense possibly damaging 0.94
R8546:Fnip1 UTSW 11 54,400,826 (GRCm39) missense probably benign 0.23
R8753:Fnip1 UTSW 11 54,400,867 (GRCm39) missense probably damaging 0.99
R8834:Fnip1 UTSW 11 54,395,581 (GRCm39) missense possibly damaging 0.83
R8875:Fnip1 UTSW 11 54,406,380 (GRCm39) missense probably damaging 1.00
R9605:Fnip1 UTSW 11 54,381,713 (GRCm39) missense probably benign 0.02
R9735:Fnip1 UTSW 11 54,394,273 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACTGTTGGTGAAATTTTCCAGG -3'
(R):5'- ACCACTGCTCAGATGTCCAG -3'

Sequencing Primer
(F):5'- GCTTTTGTCTAGGATAAGCACC -3'
(R):5'- GCGTTCACCTAAAGCGTA -3'
Posted On 2016-03-17