Mutagenetix > Incidental Mutations

Incidental Mutation 'R0280:Esr1'

37468

Institutional Source

Beutler Lab

Gene Symbol

Esr1

Ensembl Gene

ENSMUSG00000019768

Gene Name

estrogen receptor 1 (alpha)

Synonyms

ERalpha, ERa, ER[a], Estra, Nr3a1, ESR, ER-alpha, Estr

MMRRC Submission

038502-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.944) question?

Stock #

R0280 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4611593-5005614 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 4856951 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 289 (D289G)

Ref Sequence

ENSEMBL: ENSMUSP00000101213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067086] [ENSMUST00000105588] [ENSMUST00000105589] [ENSMUST00000105590]

AlphaFold

P19785

Predicted Effect

probably benign
Transcript: ENSMUST00000067086
AA Change: D289G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000070070
Gene: ENSMUSG00000019768
AA Change: D289G

Domain	Start	End	E-Value	Type
Pfam:Oest_recep	42	185	8.1e-57	PFAM
ZnF_C4	186	257	1.93e-37	SMART
HOLI	352	522	1.23e-35	SMART
Blast:HOLI	523	554	4e-11	BLAST
Pfam:ESR1_C	556	599	1.1e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000105588
AA Change: D289G

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000101213
Gene: ENSMUSG00000019768
AA Change: D289G

Domain	Start	End	E-Value	Type
Pfam:Oest_recep	42	185	1.7e-57	PFAM
ZnF_C4	186	257	1.93e-37	SMART
HOLI	352	493	4.19e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105589
AA Change: D289G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000101214
Gene: ENSMUSG00000019768
AA Change: D289G

Domain	Start	End	E-Value	Type
Pfam:Oest_recep	42	185	2.3e-64	PFAM
ZnF_C4	186	257	1.93e-37	SMART
HOLI	352	522	1.23e-35	SMART
Blast:HOLI	523	554	4e-11	BLAST
Pfam:ESR1_C	556	599	1.9e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000105590
AA Change: D289G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000101215
Gene: ENSMUSG00000019768
AA Change: D289G

Domain	Start	End	E-Value	Type
Pfam:Oest_recep	42	185	8.1e-57	PFAM
ZnF_C4	186	257	1.93e-37	SMART
HOLI	352	522	1.23e-35	SMART
Blast:HOLI	523	554	4e-11	BLAST
Pfam:ESR1_C	556	599	1.1e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138828

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149195

Meta Mutation Damage Score

0.0847

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.9%
20x: 94.6%

Validation Efficiency

96% (55/57)

MGI Phenotype

FUNCTION: This gene encodes an estrogen receptor, a member of the nuclear hormone family of intracellular receptors. The encoded protein, activated by the sex hormone estrogen, is a transcription factor composed of several domains important for hormone binding, DNA binding, and activation of transcription. Estrogen and its receptors are essential for sexual development and reproductive function, but also play a role in other tissues such as bone. Similar genes in human have been implicated in pathological processes including breast cancer, endometrial cancer, and osteoporosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for targeted null mutations have reduced skeletal growth and are infertile. Females exhibit hypoplastic uteri and nonovulatory ovaries, while males produce few sperm of low motility and fertilizing capacity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
Adam18	C	T	8: 24,674,054	G38R	probably benign	Het
Ankrd16	T	G	2: 11,781,501	V187G	probably damaging	Het
AU019823	T	C	9: 50,609,379	T123A	probably damaging	Het
Ccdc110	A	T	8: 45,943,450	N793Y	probably benign	Het
Ccdc170	T	C	10: 4,558,663	I629T	possibly damaging	Het
Clcn6	A	G	4: 148,008,715	L836P	probably damaging	Het
Colgalt2	G	T	1: 152,508,561	A551S	possibly damaging	Het
Crocc	T	C	4: 141,028,426	E1097G	probably damaging	Het
Csmd1	A	T	8: 16,271,602	V494E	probably damaging	Het
Drg1	A	T	11: 3,256,537		probably null	Het
Dscam	T	C	16: 97,039,006	K134E	possibly damaging	Het
Dyrk1b	T	C	7: 28,184,312	Y198H	probably damaging	Het
Evi5l	T	C	8: 4,193,133	V339A	probably damaging	Het
Fat4	A	T	3: 38,890,816	Q1286L	probably benign	Het
Frem1	T	C	4: 82,969,444	H1118R	probably damaging	Het
Fuk	A	T	8: 110,894,748	V188D	probably damaging	Het
Fut9	C	T	4: 25,619,852	D321N	probably benign	Het
Gaa	T	G	11: 119,284,547	V917G	probably damaging	Het
Gm973	GCC	GC	1: 59,544,680		probably null	Het
Kidins220	A	G	12: 25,010,141	T767A	probably damaging	Het
Kif7	A	G	7: 79,698,823	S1257P	probably benign	Het
Ltn1	A	G	16: 87,397,838	L1391P	probably damaging	Het
Mast3	A	G	8: 70,783,795	Y681H	probably damaging	Het
Mast3	A	G	8: 70,787,920	V291A	possibly damaging	Het
Metrn	C	T	17: 25,795,135	R239H	probably benign	Het
Mphosph10	C	A	7: 64,376,703	K666N	possibly damaging	Het
Mtbp	C	T	15: 55,586,461	T433I	probably benign	Het
Mtmr2	A	G	9: 13,799,249	K365E	probably damaging	Het
Nanog	A	G	6: 122,713,398	D229G	probably damaging	Het
Npepps	T	C	11: 97,241,014	N338S	possibly damaging	Het
Nphp4	T	A	4: 152,551,936		probably benign	Het
Olfr1279	T	C	2: 111,307,072	F289S	possibly damaging	Het
Plcl2	A	G	17: 50,607,034	E357G	probably damaging	Het
Polb	A	T	8: 22,640,392	Y173N	probably damaging	Het
R3hdm1	T	A	1: 128,162,775	S74T	probably benign	Het
Raet1d	T	A	10: 22,370,883	C37S	probably damaging	Het
Reln	G	A	5: 22,227,513		probably benign	Het
Rps6kc1	T	C	1: 190,809,000	S369G	probably damaging	Het
Sgf29	A	G	7: 126,671,571	E108G	probably benign	Het
Sh3tc1	A	G	5: 35,706,017	L942P	probably damaging	Het
Slc22a27	A	T	19: 7,896,822	L188*	probably null	Het
Slc9a3	T	A	13: 74,159,424	I445N	probably damaging	Het
Sufu	A	T	19: 46,450,673		probably benign	Het
Tomm40	G	A	7: 19,713,751	T118I	probably damaging	Het
Ttc25	A	T	11: 100,550,265	K107N	probably damaging	Het
Ttn	C	T	2: 76,740,479	R26690H	probably damaging	Het
Vmn2r16	A	G	5: 109,340,139	I293V	possibly damaging	Het
Vmn2r68	T	A	7: 85,233,249		probably benign	Het
Vmn2r68	C	G	7: 85,233,258		probably null	Het
Vsig8	A	G	1: 172,561,538	D119G	probably benign	Het

Other mutations in Esr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00895:Esr1	APN	10	4997890	missense	probably benign	0.00
IGL01886:Esr1	APN	10	4856861	missense	probably damaging	0.98
IGL02174:Esr1	APN	10	4998003	missense	probably damaging	1.00
IGL02625:Esr1	APN	10	5001346	missense	probably benign	0.00
IGL02938:Esr1	APN	10	4783872	missense	probably damaging	1.00
IGL03232:Esr1	APN	10	4969270	missense	probably damaging	1.00
cybernetic	UTSW	10	4783874	missense	probably damaging	1.00
terminatrix	UTSW	10	4746760	missense	probably damaging	1.00
R0280:Esr1	UTSW	10	4939289	missense	probably damaging	0.99
R0479:Esr1	UTSW	10	4997911	missense	probably damaging	1.00
R0943:Esr1	UTSW	10	4746781	missense	probably damaging	1.00
R1437:Esr1	UTSW	10	4712571	small deletion	probably benign
R1581:Esr1	UTSW	10	4997905	missense	probably damaging	1.00
R1644:Esr1	UTSW	10	5001380	missense	probably benign	0.00
R1647:Esr1	UTSW	10	5001260	missense	possibly damaging	0.76
R1648:Esr1	UTSW	10	5001260	missense	possibly damaging	0.76
R1791:Esr1	UTSW	10	4783913	missense	probably damaging	1.00
R1955:Esr1	UTSW	10	4857125	missense	probably damaging	1.00
R2870:Esr1	UTSW	10	4997890	missense	probably damaging	0.98
R2870:Esr1	UTSW	10	4997890	missense	probably damaging	0.98
R4323:Esr1	UTSW	10	5001307	missense	possibly damaging	0.48
R4727:Esr1	UTSW	10	5001418	missense	probably benign	0.00
R5009:Esr1	UTSW	10	4712394	missense	probably damaging	1.00
R5578:Esr1	UTSW	10	4969164	missense	probably damaging	1.00
R5610:Esr1	UTSW	10	5001221	missense	probably damaging	1.00
R5836:Esr1	UTSW	10	4712817	missense	probably benign	0.02
R5938:Esr1	UTSW	10	4966245	intron	probably benign
R6030:Esr1	UTSW	10	4746622	missense	possibly damaging	0.93
R6030:Esr1	UTSW	10	4746622	missense	possibly damaging	0.93
R6173:Esr1	UTSW	10	4746760	missense	probably damaging	1.00
R6575:Esr1	UTSW	10	4966301	intron	probably benign
R6888:Esr1	UTSW	10	4857076	missense	probably benign	0.00
R7271:Esr1	UTSW	10	4783874	missense	probably damaging	1.00
R7310:Esr1	UTSW	10	4939259	missense	probably damaging	1.00
R7552:Esr1	UTSW	10	4856903	missense	probably damaging	1.00
R8218:Esr1	UTSW	10	4746808	critical splice donor site	probably null
R8553:Esr1	UTSW	10	4997847	missense	probably damaging	1.00
R8801:Esr1	UTSW	10	4966270	missense	unknown
R8904:Esr1	UTSW	10	4746654	missense	possibly damaging	0.95
R8924:Esr1	UTSW	10	4857176	nonsense	probably null
R9261:Esr1	UTSW	10	4969271	missense	probably damaging	0.97
R9314:Esr1	UTSW	10	4966181	missense	possibly damaging	0.84
R9339:Esr1	UTSW	10	4746798	missense	probably damaging	0.99
R9351:Esr1	UTSW	10	4746763	nonsense	probably null
R9388:Esr1	UTSW	10	4969179	missense	probably benign	0.05
X0011:Esr1	UTSW	10	4712571	small deletion	probably benign
X0018:Esr1	UTSW	10	5001325	missense	probably benign
Z1088:Esr1	UTSW	10	4712667	missense	possibly damaging	0.49

Predicted Primers

PCR Primer
(F):5'- AAGTGCCACAAATCAATGCTGTTCC -3'
(R):5'- AGGCTTCACTGAAGGGTCTAGAAGG -3'

Sequencing Primer
(F):5'- GCGCTATTATCTTGGAAGACAG -3'
(R):5'- CTGAAGGGTCTAGAAGGATCATATTC -3'

Posted On

2013-05-23