Incidental Mutation 'R4863:Ncor1'
ID 374680
Institutional Source Beutler Lab
Gene Symbol Ncor1
Ensembl Gene ENSMUSG00000018501
Gene Name nuclear receptor co-repressor 1
Synonyms Rxrip13, 5730405M06Rik, A230020K14Rik, N-CoR
MMRRC Submission 042473-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4863 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 62207132-62348200 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 62283464 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 408 (M408L)
Ref Sequence ENSEMBL: ENSMUSP00000098627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018645] [ENSMUST00000101066] [ENSMUST00000101067] [ENSMUST00000127471] [ENSMUST00000151498] [ENSMUST00000155486]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000018645
AA Change: M408L

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000018645
Gene: ENSMUSG00000018501
AA Change: M408L

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
Pfam:GPS2_interact 150 239 1.4e-37 PFAM
coiled coil region 302 329 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
SANT 437 485 2.76e-7 SMART
coiled coil region 507 544 N/A INTRINSIC
low complexity region 593 617 N/A INTRINSIC
SANT 624 672 3.29e-14 SMART
low complexity region 710 731 N/A INTRINSIC
low complexity region 771 788 N/A INTRINSIC
low complexity region 888 899 N/A INTRINSIC
low complexity region 987 995 N/A INTRINSIC
low complexity region 1002 1013 N/A INTRINSIC
low complexity region 1036 1049 N/A INTRINSIC
internal_repeat_2 1061 1298 1.62e-6 PROSPERO
internal_repeat_2 1299 1515 1.62e-6 PROSPERO
low complexity region 1516 1527 N/A INTRINSIC
coiled coil region 1712 1749 N/A INTRINSIC
low complexity region 1834 1848 N/A INTRINSIC
low complexity region 1969 1980 N/A INTRINSIC
low complexity region 2036 2055 N/A INTRINSIC
PDB:3N00|B 2064 2084 4e-7 PDB
low complexity region 2086 2101 N/A INTRINSIC
low complexity region 2157 2168 N/A INTRINSIC
PDB:2OVM|B 2267 2290 2e-8 PDB
low complexity region 2311 2324 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101066
AA Change: M408L

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098627
Gene: ENSMUSG00000018501
AA Change: M408L

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
coiled coil region 176 217 N/A INTRINSIC
coiled coil region 302 329 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
SANT 437 485 2.76e-7 SMART
coiled coil region 507 544 N/A INTRINSIC
low complexity region 593 617 N/A INTRINSIC
SANT 624 672 3.29e-14 SMART
low complexity region 710 731 N/A INTRINSIC
low complexity region 771 788 N/A INTRINSIC
low complexity region 888 899 N/A INTRINSIC
low complexity region 987 995 N/A INTRINSIC
low complexity region 1002 1013 N/A INTRINSIC
low complexity region 1036 1049 N/A INTRINSIC
internal_repeat_2 1061 1298 1.62e-6 PROSPERO
internal_repeat_2 1299 1515 1.62e-6 PROSPERO
low complexity region 1516 1527 N/A INTRINSIC
coiled coil region 1712 1749 N/A INTRINSIC
low complexity region 1834 1848 N/A INTRINSIC
low complexity region 1969 1980 N/A INTRINSIC
low complexity region 2036 2055 N/A INTRINSIC
PDB:3N00|B 2064 2084 4e-7 PDB
low complexity region 2086 2101 N/A INTRINSIC
low complexity region 2157 2168 N/A INTRINSIC
PDB:2OVM|B 2267 2290 2e-8 PDB
low complexity region 2311 2324 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101067
AA Change: M408L

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098628
Gene: ENSMUSG00000018501
AA Change: M408L

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
coiled coil region 176 217 N/A INTRINSIC
coiled coil region 302 329 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
SANT 437 485 2.76e-7 SMART
coiled coil region 507 544 N/A INTRINSIC
low complexity region 593 617 N/A INTRINSIC
SANT 624 672 3.29e-14 SMART
low complexity region 716 734 N/A INTRINSIC
low complexity region 838 849 N/A INTRINSIC
low complexity region 937 945 N/A INTRINSIC
low complexity region 952 963 N/A INTRINSIC
low complexity region 986 999 N/A INTRINSIC
low complexity region 1448 1459 N/A INTRINSIC
coiled coil region 1645 1682 N/A INTRINSIC
low complexity region 1767 1781 N/A INTRINSIC
low complexity region 1902 1913 N/A INTRINSIC
low complexity region 1969 1988 N/A INTRINSIC
PDB:3N00|B 1997 2017 4e-7 PDB
low complexity region 2019 2034 N/A INTRINSIC
low complexity region 2089 2100 N/A INTRINSIC
PDB:2OVM|B 2199 2222 2e-8 PDB
low complexity region 2243 2256 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000101068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124027
Predicted Effect probably benign
Transcript: ENSMUST00000127471
AA Change: M408L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000121806
Gene: ENSMUSG00000018501
AA Change: M408L

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
coiled coil region 176 217 N/A INTRINSIC
coiled coil region 302 329 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
SANT 437 485 2.76e-7 SMART
coiled coil region 508 545 N/A INTRINSIC
low complexity region 594 618 N/A INTRINSIC
SANT 625 673 3.29e-14 SMART
low complexity region 711 732 N/A INTRINSIC
low complexity region 756 773 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000151498
AA Change: M8L

PolyPhen 2 Score 0.758 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125317
Gene: ENSMUSG00000018501
AA Change: M8L

DomainStartEndE-ValueType
SANT 37 85 2.76e-7 SMART
coiled coil region 107 144 N/A INTRINSIC
low complexity region 193 217 N/A INTRINSIC
SANT 224 272 3.29e-14 SMART
low complexity region 316 337 N/A INTRINSIC
low complexity region 361 378 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 577 585 N/A INTRINSIC
low complexity region 592 603 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
internal_repeat_2 700 830 5.77e-7 PROSPERO
internal_repeat_2 855 961 5.77e-7 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160171
Predicted Effect probably benign
Transcript: ENSMUST00000155486
AA Change: M417L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122647
Gene: ENSMUSG00000018501
AA Change: M417L

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
coiled coil region 176 217 N/A INTRINSIC
coiled coil region 311 338 N/A INTRINSIC
low complexity region 358 375 N/A INTRINSIC
SANT 446 494 2.76e-7 SMART
coiled coil region 516 541 N/A INTRINSIC
Meta Mutation Damage Score 0.0607 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (105/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that mediates ligand-independent transcription repression of thyroid-hormone and retinoic-acid receptors by promoting chromatin condensation and preventing access of the transcription machinery. It is part of a complex which also includes histone deacetylases and transcriptional regulators similar to the yeast protein Sin3p. This gene is located between the Charcot-Marie-Tooth and Smith-Magenis syndrome critical regions on chromosome 17. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 17 and 20.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene exhibit embryonic lethality with erythrocytic, thymocytic and central nervous system development abnormalities. Mice homozygous for a hypomorphic allele exhibit increased thyroid hormone sensitivity under hypothyroid conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 64,210,658 (GRCm39) R190H probably benign Het
Abcc12 T A 8: 87,265,005 (GRCm39) I647F probably damaging Het
Acnat2 C A 4: 49,380,172 (GRCm39) W384L probably damaging Het
Acvr1 A G 2: 58,367,723 (GRCm39) L146P possibly damaging Het
Ankrd16 T A 2: 11,789,127 (GRCm39) M238K probably benign Het
Clmn A T 12: 104,763,353 (GRCm39) I91N probably damaging Het
Cog8 A T 8: 107,776,806 (GRCm39) L523H probably damaging Het
Cpxm2 T A 7: 131,661,476 (GRCm39) K437M probably benign Het
Dhx57 A T 17: 80,560,540 (GRCm39) V999E probably damaging Het
Dnpep T C 1: 75,285,874 (GRCm39) probably benign Het
Dok3 G A 13: 55,671,270 (GRCm39) R434W probably damaging Het
Dpysl5 C T 5: 30,941,687 (GRCm39) H275Y probably benign Het
Ednra A T 8: 78,394,012 (GRCm39) N361K probably damaging Het
Ei24 A T 9: 36,695,861 (GRCm39) S210R probably damaging Het
Erich3 T A 3: 154,470,441 (GRCm39) V158E unknown Het
Fam193a T A 5: 34,623,549 (GRCm39) V1379E possibly damaging Het
Fasn A G 11: 120,699,654 (GRCm39) V2304A probably damaging Het
Fcgbp A C 7: 27,785,769 (GRCm39) D402A probably benign Het
Fkbp14 T C 6: 54,562,930 (GRCm39) probably benign Het
Fnip1 G A 11: 54,406,382 (GRCm39) V1160I possibly damaging Het
Fsd2 T C 7: 81,202,712 (GRCm39) K289R probably null Het
Fuca2 A T 10: 13,381,651 (GRCm39) D188V probably damaging Het
Gfpt2 T C 11: 49,701,797 (GRCm39) V116A probably benign Het
Gm10770 T A 2: 150,020,816 (GRCm39) K234* probably null Het
Gm9887 A G 12: 69,418,763 (GRCm39) probably benign Het
Gtf3c2 A G 5: 31,316,577 (GRCm39) probably benign Het
H2-M10.3 T C 17: 36,677,528 (GRCm39) D250G probably damaging Het
Hapln4 G A 8: 70,537,142 (GRCm39) V26M possibly damaging Het
Hook3 G A 8: 26,528,057 (GRCm39) A611V probably damaging Het
Hr T C 14: 70,809,412 (GRCm39) L1141P probably damaging Het
Ifngr1 T C 10: 19,485,164 (GRCm39) S388P probably damaging Het
Itga3 T A 11: 94,952,793 (GRCm39) Q326L probably damaging Het
Itgb3 T A 11: 104,556,346 (GRCm39) I729N probably damaging Het
Kcnab2 A G 4: 152,486,403 (GRCm39) S132P probably damaging Het
Lama3 C T 18: 12,672,850 (GRCm39) A2481V probably damaging Het
Lama3 T C 18: 12,631,735 (GRCm39) probably benign Het
Lce1e A T 3: 92,615,178 (GRCm39) C56* probably null Het
Lmcd1 T C 6: 112,264,832 (GRCm39) probably benign Het
Lrrc14 T A 15: 76,597,562 (GRCm39) probably null Het
Lypd8l A T 11: 58,503,338 (GRCm39) probably null Het
Map4k5 G A 12: 69,865,212 (GRCm39) P591L probably benign Het
Mapk13 C A 17: 28,995,284 (GRCm39) D168E probably damaging Het
Marf1 A C 16: 13,950,529 (GRCm39) H952Q possibly damaging Het
Megf6 T C 4: 154,338,738 (GRCm39) probably null Het
Mical3 T C 6: 121,010,748 (GRCm39) I411M probably damaging Het
Myo5a A T 9: 75,124,789 (GRCm39) K1781N probably damaging Het
N4bp2 T C 5: 65,965,473 (GRCm39) V1174A probably benign Het
Ncdn A T 4: 126,644,216 (GRCm39) L202Q probably damaging Het
Nf1 T C 11: 79,300,235 (GRCm39) L249P probably damaging Het
Nlrp9b T A 7: 19,783,521 (GRCm39) probably null Het
Nxpe3 A T 16: 55,669,996 (GRCm39) Y370N probably damaging Het
P2rx2 T A 5: 110,489,434 (GRCm39) T167S probably benign Het
Pcdhb19 G T 18: 37,632,161 (GRCm39) R652L probably benign Het
Pcdhga12 T C 18: 37,901,334 (GRCm39) L722P probably benign Het
Pde6a A T 18: 61,378,663 (GRCm39) I329F probably damaging Het
Pdpr T A 8: 111,828,583 (GRCm39) S29T probably benign Het
Pfkfb3 T C 2: 11,491,123 (GRCm39) D173G probably benign Het
Plcd4 A G 1: 74,604,961 (GRCm39) probably null Het
Polr1g T A 7: 19,091,684 (GRCm39) Q141L probably damaging Het
Pou2f2 A G 7: 24,796,533 (GRCm39) probably benign Het
Ppp1r14c TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGG 10: 3,316,702 (GRCm39) probably benign Het
Ppp1r42 T C 1: 10,073,611 (GRCm39) probably benign Het
Ptpre C T 7: 135,270,861 (GRCm39) H346Y probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rab12 A T 17: 66,805,103 (GRCm39) Y142N probably damaging Het
Rai14 A C 15: 10,572,556 (GRCm39) M857R probably damaging Het
Ranbp2 A G 10: 58,328,243 (GRCm39) K2753R probably damaging Het
Rasa4 A T 5: 136,132,765 (GRCm39) K6* probably null Het
Rasgef1a A G 6: 118,066,100 (GRCm39) M438V probably benign Het
Recql T G 6: 142,304,732 (GRCm39) probably benign Het
Rftn2 A G 1: 55,211,198 (GRCm39) V425A probably benign Het
Ror1 A G 4: 100,267,001 (GRCm39) Y234C probably damaging Het
Sap30l T A 11: 57,696,880 (GRCm39) L70Q probably damaging Het
Scn4a T C 11: 106,210,828 (GRCm39) R1730G probably damaging Het
Serinc5 T G 13: 92,827,488 (GRCm39) I268R probably damaging Het
Sin3b G A 8: 73,471,576 (GRCm39) V432I possibly damaging Het
Slc30a6 T C 17: 74,719,649 (GRCm39) M203T possibly damaging Het
Soat1 T C 1: 156,259,898 (GRCm39) N481S probably damaging Het
Sos2 G A 12: 69,686,928 (GRCm39) T206I probably benign Het
Sp100 G T 1: 85,632,724 (GRCm39) A132S probably benign Het
Sp140l1 C T 1: 85,066,521 (GRCm39) probably benign Het
Spata31d1c T A 13: 65,183,604 (GRCm39) L382* probably null Het
Stard9 T A 2: 120,531,341 (GRCm39) W2533R probably benign Het
Tas2r126 A G 6: 42,412,324 (GRCm39) T286A probably benign Het
Tedc2 T A 17: 24,436,910 (GRCm39) K275M probably damaging Het
Ten1 A T 11: 116,109,057 (GRCm39) K242N probably benign Het
Thoc2l A T 5: 104,665,616 (GRCm39) D46V possibly damaging Het
Tial1 C T 7: 128,056,752 (GRCm39) V1I probably damaging Het
Tle2 G A 10: 81,424,725 (GRCm39) R649H possibly damaging Het
Tmem178 A G 17: 81,252,374 (GRCm39) D86G probably benign Het
Trim29 T A 9: 43,240,872 (GRCm39) D528E possibly damaging Het
Vmn2r61 A T 7: 41,950,132 (GRCm39) T851S probably benign Het
Vmn2r72 T A 7: 85,399,806 (GRCm39) Q414H possibly damaging Het
Yars1 A T 4: 129,083,675 (GRCm39) probably benign Het
Yipf4 A G 17: 74,801,087 (GRCm39) Q135R probably damaging Het
Zfp341 G A 2: 154,487,786 (GRCm39) probably benign Het
Zfp426 T C 9: 20,381,334 (GRCm39) Y536C probably damaging Het
Zp2 T G 7: 119,734,995 (GRCm39) Y430S probably damaging Het
Other mutations in Ncor1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Ncor1 APN 11 62,283,354 (GRCm39) missense probably damaging 1.00
IGL01343:Ncor1 APN 11 62,216,312 (GRCm39) critical splice donor site probably null
IGL01392:Ncor1 APN 11 62,231,420 (GRCm39) missense probably damaging 0.99
IGL01402:Ncor1 APN 11 62,231,300 (GRCm39) missense probably damaging 1.00
IGL01714:Ncor1 APN 11 62,225,410 (GRCm39) missense possibly damaging 0.58
IGL01772:Ncor1 APN 11 62,240,173 (GRCm39) intron probably benign
IGL01889:Ncor1 APN 11 62,225,427 (GRCm39) missense possibly damaging 0.69
IGL02058:Ncor1 APN 11 62,235,463 (GRCm39) missense probably damaging 1.00
IGL02065:Ncor1 APN 11 62,310,435 (GRCm39) missense possibly damaging 0.95
IGL02073:Ncor1 APN 11 62,249,743 (GRCm39) missense probably damaging 0.99
IGL02176:Ncor1 APN 11 62,220,485 (GRCm39) unclassified probably benign
IGL02288:Ncor1 APN 11 62,240,229 (GRCm39) missense probably benign 0.01
IGL02348:Ncor1 APN 11 62,224,485 (GRCm39) splice site probably benign
IGL02608:Ncor1 APN 11 62,264,040 (GRCm39) missense probably benign 0.07
laggard UTSW 11 62,260,130 (GRCm39) missense probably damaging 1.00
Shortstep UTSW 11 62,225,367 (GRCm39) missense probably damaging 1.00
LCD18:Ncor1 UTSW 11 62,419,782 (GRCm38) critical splice acceptor site probably benign
PIT4382001:Ncor1 UTSW 11 62,235,489 (GRCm39) missense probably damaging 0.96
PIT4576001:Ncor1 UTSW 11 62,224,543 (GRCm39) missense probably damaging 0.99
R0026:Ncor1 UTSW 11 62,329,255 (GRCm39) missense probably damaging 1.00
R0038:Ncor1 UTSW 11 62,283,377 (GRCm39) missense probably damaging 0.99
R0038:Ncor1 UTSW 11 62,283,377 (GRCm39) missense probably damaging 0.99
R0103:Ncor1 UTSW 11 62,233,871 (GRCm39) missense possibly damaging 0.85
R0103:Ncor1 UTSW 11 62,233,871 (GRCm39) missense possibly damaging 0.85
R0144:Ncor1 UTSW 11 62,283,421 (GRCm39) missense probably damaging 1.00
R0427:Ncor1 UTSW 11 62,301,746 (GRCm39) missense probably damaging 1.00
R0501:Ncor1 UTSW 11 62,264,148 (GRCm39) missense possibly damaging 0.73
R0544:Ncor1 UTSW 11 62,224,603 (GRCm39) missense probably damaging 1.00
R0544:Ncor1 UTSW 11 62,224,602 (GRCm39) missense probably damaging 1.00
R0563:Ncor1 UTSW 11 62,234,056 (GRCm39) missense probably damaging 0.97
R1074:Ncor1 UTSW 11 62,283,377 (GRCm39) missense probably damaging 0.99
R1266:Ncor1 UTSW 11 62,224,866 (GRCm39) missense probably damaging 0.98
R1444:Ncor1 UTSW 11 62,294,632 (GRCm39) missense probably damaging 1.00
R1452:Ncor1 UTSW 11 62,225,457 (GRCm39) missense probably damaging 1.00
R1534:Ncor1 UTSW 11 62,269,330 (GRCm39) missense possibly damaging 0.92
R1710:Ncor1 UTSW 11 62,313,831 (GRCm39) missense probably damaging 1.00
R1762:Ncor1 UTSW 11 62,275,610 (GRCm39) missense possibly damaging 0.82
R1771:Ncor1 UTSW 11 62,217,938 (GRCm39) missense probably damaging 1.00
R1864:Ncor1 UTSW 11 62,272,245 (GRCm39) missense probably damaging 1.00
R1902:Ncor1 UTSW 11 62,228,984 (GRCm39) missense probably damaging 1.00
R1906:Ncor1 UTSW 11 62,240,211 (GRCm39) missense possibly damaging 0.81
R2009:Ncor1 UTSW 11 62,216,427 (GRCm39) missense probably benign 0.43
R3708:Ncor1 UTSW 11 62,235,513 (GRCm39) missense probably damaging 1.00
R3825:Ncor1 UTSW 11 62,264,183 (GRCm39) missense probably benign 0.00
R3923:Ncor1 UTSW 11 62,216,442 (GRCm39) missense probably damaging 1.00
R3966:Ncor1 UTSW 11 62,235,583 (GRCm39) missense probably damaging 1.00
R4049:Ncor1 UTSW 11 62,220,494 (GRCm39) splice site probably null
R4350:Ncor1 UTSW 11 62,301,644 (GRCm39) critical splice donor site probably null
R4351:Ncor1 UTSW 11 62,301,644 (GRCm39) critical splice donor site probably null
R4359:Ncor1 UTSW 11 62,249,736 (GRCm39) missense probably damaging 1.00
R4712:Ncor1 UTSW 11 62,235,660 (GRCm39) missense probably damaging 1.00
R4723:Ncor1 UTSW 11 62,269,438 (GRCm39) missense probably benign 0.26
R4875:Ncor1 UTSW 11 62,324,437 (GRCm39) small deletion probably benign
R4956:Ncor1 UTSW 11 62,231,431 (GRCm39) missense probably damaging 1.00
R4993:Ncor1 UTSW 11 62,234,167 (GRCm39) missense probably damaging 1.00
R5079:Ncor1 UTSW 11 62,236,063 (GRCm39) missense possibly damaging 0.92
R5144:Ncor1 UTSW 11 62,240,290 (GRCm39) missense probably damaging 1.00
R5223:Ncor1 UTSW 11 62,229,826 (GRCm39) missense probably damaging 1.00
R5243:Ncor1 UTSW 11 62,229,788 (GRCm39) missense probably damaging 1.00
R5271:Ncor1 UTSW 11 62,231,371 (GRCm39) missense probably damaging 1.00
R5285:Ncor1 UTSW 11 62,283,475 (GRCm39) missense probably damaging 1.00
R5533:Ncor1 UTSW 11 62,233,837 (GRCm39) missense probably benign 0.00
R5580:Ncor1 UTSW 11 62,280,604 (GRCm39) nonsense probably null
R5593:Ncor1 UTSW 11 62,260,130 (GRCm39) missense probably damaging 1.00
R5609:Ncor1 UTSW 11 62,249,679 (GRCm39) splice site probably null
R5632:Ncor1 UTSW 11 62,229,060 (GRCm39) missense possibly damaging 0.85
R5830:Ncor1 UTSW 11 62,235,589 (GRCm39) missense possibly damaging 0.71
R5896:Ncor1 UTSW 11 62,274,016 (GRCm39) missense probably damaging 1.00
R5973:Ncor1 UTSW 11 62,240,136 (GRCm39) splice site probably null
R6013:Ncor1 UTSW 11 62,211,903 (GRCm39) missense probably benign
R6019:Ncor1 UTSW 11 62,263,987 (GRCm39) missense probably benign 0.00
R6032:Ncor1 UTSW 11 62,264,147 (GRCm39) missense possibly damaging 0.54
R6032:Ncor1 UTSW 11 62,264,147 (GRCm39) missense possibly damaging 0.54
R6075:Ncor1 UTSW 11 62,208,675 (GRCm39) missense probably damaging 1.00
R6091:Ncor1 UTSW 11 62,310,443 (GRCm39) missense probably damaging 0.98
R6248:Ncor1 UTSW 11 62,257,808 (GRCm39) missense probably damaging 1.00
R6281:Ncor1 UTSW 11 62,264,371 (GRCm39) missense possibly damaging 0.71
R6351:Ncor1 UTSW 11 62,264,124 (GRCm39) missense probably benign 0.30
R6469:Ncor1 UTSW 11 62,234,128 (GRCm39) missense probably damaging 1.00
R6502:Ncor1 UTSW 11 62,272,240 (GRCm39) nonsense probably null
R6614:Ncor1 UTSW 11 62,221,645 (GRCm39) missense probably benign 0.01
R6650:Ncor1 UTSW 11 62,225,367 (GRCm39) missense probably damaging 1.00
R6765:Ncor1 UTSW 11 62,264,272 (GRCm39) missense probably benign 0.01
R6852:Ncor1 UTSW 11 62,234,071 (GRCm39) missense probably damaging 0.97
R6909:Ncor1 UTSW 11 62,220,312 (GRCm39) missense probably damaging 1.00
R6965:Ncor1 UTSW 11 62,244,059 (GRCm39) critical splice donor site probably null
R7054:Ncor1 UTSW 11 62,275,619 (GRCm39) missense probably null
R7248:Ncor1 UTSW 11 62,275,598 (GRCm39) missense possibly damaging 0.89
R7352:Ncor1 UTSW 11 62,224,737 (GRCm39) missense probably damaging 0.99
R7396:Ncor1 UTSW 11 62,234,044 (GRCm39) missense probably damaging 0.99
R7434:Ncor1 UTSW 11 62,274,025 (GRCm39) missense probably damaging 0.99
R7552:Ncor1 UTSW 11 62,264,250 (GRCm39) missense possibly damaging 0.53
R7565:Ncor1 UTSW 11 62,292,091 (GRCm39) missense probably damaging 1.00
R7575:Ncor1 UTSW 11 62,274,082 (GRCm39) missense probably benign 0.21
R7622:Ncor1 UTSW 11 62,208,794 (GRCm39) missense probably benign 0.00
R7664:Ncor1 UTSW 11 62,289,154 (GRCm39) missense probably damaging 1.00
R7814:Ncor1 UTSW 11 62,224,752 (GRCm39) missense probably damaging 0.99
R7963:Ncor1 UTSW 11 62,225,359 (GRCm39) missense probably benign 0.28
R7990:Ncor1 UTSW 11 62,240,321 (GRCm39) critical splice acceptor site probably null
R8302:Ncor1 UTSW 11 62,224,681 (GRCm39) missense probably benign 0.00
R8334:Ncor1 UTSW 11 62,274,070 (GRCm39) missense probably damaging 0.99
R8512:Ncor1 UTSW 11 62,324,437 (GRCm39) small deletion probably benign
R8728:Ncor1 UTSW 11 62,221,685 (GRCm39) missense probably benign 0.04
R8777:Ncor1 UTSW 11 62,324,494 (GRCm39) missense probably damaging 1.00
R8777:Ncor1 UTSW 11 62,324,492 (GRCm39) missense probably benign 0.03
R8777-TAIL:Ncor1 UTSW 11 62,324,494 (GRCm39) missense probably damaging 1.00
R8777-TAIL:Ncor1 UTSW 11 62,324,492 (GRCm39) missense probably benign 0.03
R8821:Ncor1 UTSW 11 62,260,234 (GRCm39) missense probably benign 0.07
R8831:Ncor1 UTSW 11 62,260,234 (GRCm39) missense probably benign 0.07
R8988:Ncor1 UTSW 11 62,233,871 (GRCm39) nonsense probably null
R9111:Ncor1 UTSW 11 62,280,585 (GRCm39) missense possibly damaging 0.95
R9147:Ncor1 UTSW 11 62,224,672 (GRCm39) missense probably damaging 1.00
R9391:Ncor1 UTSW 11 62,216,376 (GRCm39) nonsense probably null
R9467:Ncor1 UTSW 11 62,324,448 (GRCm39) small insertion probably benign
R9467:Ncor1 UTSW 11 62,324,437 (GRCm39) small insertion probably benign
R9510:Ncor1 UTSW 11 62,324,442 (GRCm39) small insertion probably benign
R9511:Ncor1 UTSW 11 62,324,449 (GRCm39) small insertion probably benign
R9560:Ncor1 UTSW 11 62,263,948 (GRCm39) missense possibly damaging 0.96
R9687:Ncor1 UTSW 11 62,260,193 (GRCm39) missense possibly damaging 0.93
X0065:Ncor1 UTSW 11 62,249,817 (GRCm39) missense probably benign 0.23
X0065:Ncor1 UTSW 11 62,245,395 (GRCm39) critical splice donor site probably null
Z1176:Ncor1 UTSW 11 62,329,342 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AAGCTTTGTGGAAAGAGTTCACTC -3'
(R):5'- AGGCCCCTCTTATAAGCTAGTAAC -3'

Sequencing Primer
(F):5'- GAGTTCACTCTCAAGTAAAAGCC -3'
(R):5'- AGACATGCTATGATGTATGAC -3'
Posted On 2016-03-17