Mutagenetix > Incidental Mutation

Incidental Mutation 'R4863:Itga3'

374682

Institutional Source

Beutler Lab

Gene Symbol

Itga3

Ensembl Gene

ENSMUSG00000001507

Gene Name

integrin alpha 3

Synonyms

VLA-3 alpha 3, alpha3-integrin

MMRRC Submission

042473-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4863 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

95044474-95076801 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 95061967 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 326 (Q326L)

Ref Sequence

ENSEMBL: ENSMUSP00000103368 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001548] [ENSMUST00000107739] [ENSMUST00000120375]

AlphaFold

Q62470

Predicted Effect

probably benign
Transcript: ENSMUST00000001548
AA Change: Q357L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000001548
Gene: ENSMUSG00000001507
AA Change: Q357L

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
Int_alpha	48	110	4.18e-7	SMART
Int_alpha	246	300	5.01e0	SMART
Int_alpha	304	361	3.07e-14	SMART
Int_alpha	366	419	4.17e-16	SMART
Int_alpha	427	483	7.57e1	SMART
low complexity region	521	534	N/A	INTRINSIC
SCOP:d1m1xa3	758	984	7e-54	SMART
transmembrane domain	994	1016	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107739
AA Change: Q326L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103368
Gene: ENSMUSG00000001507
AA Change: Q326L

Domain	Start	End	E-Value	Type
Int_alpha	20	79	1.05e2	SMART
Int_alpha	215	269	5.01e0	SMART
Int_alpha	273	330	3.07e-14	SMART
Int_alpha	335	388	4.17e-16	SMART
Int_alpha	396	452	7.57e1	SMART
low complexity region	490	503	N/A	INTRINSIC
low complexity region	775	789	N/A	INTRINSIC
transmembrane domain	963	985	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120375
AA Change: Q357L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000113556
Gene: ENSMUSG00000001507
AA Change: Q357L

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
Int_alpha	48	110	4.18e-7	SMART
Int_alpha	246	300	5.01e0	SMART
Int_alpha	304	361	3.07e-14	SMART
Int_alpha	366	419	4.17e-16	SMART
Int_alpha	427	483	7.57e1	SMART
low complexity region	521	534	N/A	INTRINSIC
SCOP:d1m1xa3	758	984	2e-53	SMART
transmembrane domain	994	1016	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140342

Predicted Effect

probably benign
Transcript: ENSMUST00000145671

SMART Domains

Protein: ENSMUSP00000115970
Gene: ENSMUSG00000001507

Domain	Start	End	E-Value	Type
Blast:Int_alpha	6	52	3e-22	BLAST
SCOP:d1m1xa4	8	182	3e-24	SMART
PDB:4IRZ\|A	12	168	2e-8	PDB
Blast:Int_alpha	55	88	2e-6	BLAST

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

99% (105/106)

MGI Phenotype

FUNCTION: This gene encodes a subunit of integrin family of cell surface proteins. The encoded protein undergoes post-translational processing to form a disulfide bond-linked dimer comprised of heavy and light chains. At the cell surface, the encoded protein non-covalently associates with the integrin beta-1 subunit to form a heterodimer that interacts with many extracellular matrix proteins including fibronectin and laminin. Mice lacking the encoded protein die during the first day after birth due to severe abnormalities in kidneys. Mice lacking the encoded protein specifically in the basal layer of epidermis display several skin defects and accelerated wound healing. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the kidney and submandibular gland, decreased bronchial branching of the lungs, skin blisters at the dermal-epidermal junction, abnormal layering of the cerebral cortex and perinatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210407C18Rik	A	T	11: 58,612,512		probably null	Het
4930578I06Rik	C	T	14: 63,973,209	R190H	probably benign	Het
A530032D15Rik	C	T	1: 85,088,800		probably benign	Het
Abcc12	T	A	8: 86,538,376	I647F	probably damaging	Het
Acnat2	C	A	4: 49,380,172	W384L	probably damaging	Het
Acvr1	A	G	2: 58,477,711	L146P	possibly damaging	Het
Ankrd16	T	A	2: 11,784,316	M238K	probably benign	Het
BC005561	A	T	5: 104,517,750	D46V	possibly damaging	Het
Cd3eap	T	A	7: 19,357,759	Q141L	probably damaging	Het
Clmn	A	T	12: 104,797,094	I91N	probably damaging	Het
Cog8	A	T	8: 107,050,174	L523H	probably damaging	Het
Cpxm2	T	A	7: 132,059,747	K437M	probably benign	Het
Dhx57	A	T	17: 80,253,111	V999E	probably damaging	Het
Dnpep	T	C	1: 75,309,230		probably benign	Het
Dok3	G	A	13: 55,523,457	R434W	probably damaging	Het
Dpysl5	C	T	5: 30,784,343	H275Y	probably benign	Het
Ednra	A	T	8: 77,667,383	N361K	probably damaging	Het
Ei24	A	T	9: 36,784,565	S210R	probably damaging	Het
Erich3	T	A	3: 154,764,804	V158E	unknown	Het
Fam193a	T	A	5: 34,466,205	V1379E	possibly damaging	Het
Fasn	A	G	11: 120,808,828	V2304A	probably damaging	Het
Fcgbp	A	C	7: 28,086,344	D402A	probably benign	Het
Fkbp14	T	C	6: 54,585,945		probably benign	Het
Fnip1	G	A	11: 54,515,556	V1160I	possibly damaging	Het
Fsd2	T	C	7: 81,552,964	K289R	probably null	Het
Fuca2	A	T	10: 13,505,907	D188V	probably damaging	Het
Gfpt2	T	C	11: 49,810,970	V116A	probably benign	Het
Gm10770	T	A	2: 150,178,896	K234*	probably null	Het
Gm9887	A	G	12: 69,371,989		probably benign	Het
Gtf3c2	A	G	5: 31,159,233		probably benign	Het
H2-M10.3	T	C	17: 36,366,636	D250G	probably damaging	Het
Hapln4	G	A	8: 70,084,492	V26M	possibly damaging	Het
Hook3	G	A	8: 26,038,029	A611V	probably damaging	Het
Hr	T	C	14: 70,571,972	L1141P	probably damaging	Het
Ifngr1	T	C	10: 19,609,416	S388P	probably damaging	Het
Itgb3	T	A	11: 104,665,520	I729N	probably damaging	Het
Kcnab2	A	G	4: 152,401,946	S132P	probably damaging	Het
Lama3	C	T	18: 12,539,793	A2481V	probably damaging	Het
Lama3	T	C	18: 12,498,678		probably benign	Het
Lce1e	A	T	3: 92,707,871	C56*	probably null	Het
Lmcd1	T	C	6: 112,287,871		probably benign	Het
Lrrc14	T	A	15: 76,713,362		probably null	Het
Map4k5	G	A	12: 69,818,438	P591L	probably benign	Het
Mapk13	C	A	17: 28,776,310	D168E	probably damaging	Het
Marf1	A	C	16: 14,132,665	H952Q	possibly damaging	Het
Megf6	T	C	4: 154,254,281		probably null	Het
Mical3	T	C	6: 121,033,787	I411M	probably damaging	Het
Myo5a	A	T	9: 75,217,507	K1781N	probably damaging	Het
N4bp2	T	C	5: 65,808,130	V1174A	probably benign	Het
Ncdn	A	T	4: 126,750,423	L202Q	probably damaging	Het
Ncor1	T	A	11: 62,392,638	M408L	possibly damaging	Het
Nf1	T	C	11: 79,409,409	L249P	probably damaging	Het
Nlrp9b	T	A	7: 20,049,596		probably null	Het
Nxpe3	A	T	16: 55,849,633	Y370N	probably damaging	Het
P2rx2	T	A	5: 110,341,568	T167S	probably benign	Het
Pcdhb19	G	T	18: 37,499,108	R652L	probably benign	Het
Pcdhga12	T	C	18: 37,768,281	L722P	probably benign	Het
Pde6a	A	T	18: 61,245,592	I329F	probably damaging	Het
Pdpr	T	A	8: 111,101,951	S29T	probably benign	Het
Pfkfb3	T	C	2: 11,486,312	D173G	probably benign	Het
Plcd4	A	G	1: 74,565,802		probably null	Het
Pou2f2	A	G	7: 25,097,108		probably benign	Het
Ppp1r14c	TGGCGGCGGCGGCGGCGG	TGGCGGCGGCGGCGG	10: 3,366,702		probably benign	Het
Ppp1r42	T	C	1: 10,003,386		probably benign	Het
Ptpre	C	T	7: 135,669,132	H346Y	probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rab12	A	T	17: 66,498,108	Y142N	probably damaging	Het
Rai14	A	C	15: 10,572,470	M857R	probably damaging	Het
Ranbp2	A	G	10: 58,492,421	K2753R	probably damaging	Het
Rasa4	A	T	5: 136,103,911	K6*	probably null	Het
Rasgef1a	A	G	6: 118,089,139	M438V	probably benign	Het
Recql	T	G	6: 142,359,006		probably benign	Het
Rftn2	A	G	1: 55,172,039	V425A	probably benign	Het
Ror1	A	G	4: 100,409,804	Y234C	probably damaging	Het
Sap30l	T	A	11: 57,806,054	L70Q	probably damaging	Het
Scn4a	T	C	11: 106,320,002	R1730G	probably damaging	Het
Serinc5	T	G	13: 92,690,980	I268R	probably damaging	Het
Sin3b	G	A	8: 72,744,948	V432I	possibly damaging	Het
Slc30a6	T	C	17: 74,412,654	M203T	possibly damaging	Het
Soat1	T	C	1: 156,432,328	N481S	probably damaging	Het
Sos2	G	A	12: 69,640,154	T206I	probably benign	Het
Sp100	G	T	1: 85,705,003	A132S	probably benign	Het
Spata31d1c	T	A	13: 65,035,790	L382*	probably null	Het
Stard9	T	A	2: 120,700,860	W2533R	probably benign	Het
Tas2r126	A	G	6: 42,435,390	T286A	probably benign	Het
Tedc2	T	A	17: 24,217,936	K275M	probably damaging	Het
Ten1	A	T	11: 116,218,231	K242N	probably benign	Het
Tial1	C	T	7: 128,455,028	V1I	probably damaging	Het
Tle2	G	A	10: 81,588,891	R649H	possibly damaging	Het
Tmem178	A	G	17: 80,944,945	D86G	probably benign	Het
Trim29	T	A	9: 43,329,575	D528E	possibly damaging	Het
Vmn2r61	A	T	7: 42,300,708	T851S	probably benign	Het
Vmn2r72	T	A	7: 85,750,598	Q414H	possibly damaging	Het
Yars	A	T	4: 129,189,882		probably benign	Het
Yipf4	A	G	17: 74,494,092	Q135R	probably damaging	Het
Zfp341	G	A	2: 154,645,866		probably benign	Het
Zfp426	T	C	9: 20,470,038	Y536C	probably damaging	Het
Zp2	T	G	7: 120,135,772	Y430S	probably damaging	Het

Other mutations in Itga3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00926:Itga3	APN	11	95065886	missense	probably damaging	1.00
IGL02020:Itga3	APN	11	95057390	missense	probably benign	0.02
IGL02413:Itga3	APN	11	95068771	missense	probably damaging	1.00
IGL02562:Itga3	APN	11	95068793	missense	probably benign	0.02
PIT4508001:Itga3	UTSW	11	95055893	missense	probably benign	0.20
R0485:Itga3	UTSW	11	95061970	missense	probably benign	0.05
R1548:Itga3	UTSW	11	95046919	critical splice donor site	probably null
R1677:Itga3	UTSW	11	95055759	missense	probably damaging	0.96
R2062:Itga3	UTSW	11	95054076	missense	possibly damaging	0.92
R2088:Itga3	UTSW	11	95052494	missense	probably benign	0.10
R2679:Itga3	UTSW	11	95068310	splice site	probably benign
R3697:Itga3	UTSW	11	95062725	missense	probably benign	0.00
R3839:Itga3	UTSW	11	95057269	critical splice donor site	probably null
R4210:Itga3	UTSW	11	95062623	missense	probably benign	0.00
R4533:Itga3	UTSW	11	95057293	missense	probably benign	0.15
R4849:Itga3	UTSW	11	95076271	missense	probably benign
R4889:Itga3	UTSW	11	95068301	missense	probably benign	0.13
R5218:Itga3	UTSW	11	95062748	missense	probably benign	0.01
R6046:Itga3	UTSW	11	95062715	missense	probably benign	0.28
R6087:Itga3	UTSW	11	95052443	critical splice donor site	probably null
R6210:Itga3	UTSW	11	95068891	intron	probably benign
R6341:Itga3	UTSW	11	95055851	splice site	probably null
R6666:Itga3	UTSW	11	95065826	missense	probably benign	0.00
R6998:Itga3	UTSW	11	95051462	missense	probably benign	0.00
R7106:Itga3	UTSW	11	95055873	missense	probably benign	0.00
R7164:Itga3	UTSW	11	95052479	missense	possibly damaging	0.85
R7267:Itga3	UTSW	11	95076362	intron	probably benign
R7421:Itga3	UTSW	11	95068855	missense	probably benign	0.20
R7514:Itga3	UTSW	11	95065896	nonsense	probably null
R7533:Itga3	UTSW	11	95046518	missense	probably benign	0.45
R7736:Itga3	UTSW	11	95076203	missense	probably damaging	1.00
R8145:Itga3	UTSW	11	95052464	missense	probably damaging	1.00
R8303:Itga3	UTSW	11	95062640	missense	probably benign	0.42
R8459:Itga3	UTSW	11	95068807	missense	probably benign
R8464:Itga3	UTSW	11	95062740	missense	probably benign	0.28
R8951:Itga3	UTSW	11	95054085	missense	probably damaging	0.99
R8984:Itga3	UTSW	11	95062565	missense	probably damaging	1.00
R9262:Itga3	UTSW	11	95065799	missense	probably benign	0.09
R9695:Itga3	UTSW	11	95055694	critical splice donor site	probably null
Z1177:Itga3	UTSW	11	95056774	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTACGACTTTGAGCTGCGAG -3'
(R):5'- GACCTGCCGTTTGCTTAATTGC -3'

Sequencing Primer
(F):5'- AGTCCTGTCAAGCTATGCAG -3'
(R):5'- CCCTTGGCAAAATCATGCTCATTAG -3'

Posted On

2016-03-17