Incidental Mutation 'R4863:Map4k5'
ID 374688
Institutional Source Beutler Lab
Gene Symbol Map4k5
Ensembl Gene ENSMUSG00000034761
Gene Name mitogen-activated protein kinase kinase kinase kinase 5
Synonyms KHS, GCKR, 4432415E19Rik, MAPKKKK5
MMRRC Submission 042473-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4863 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 69850531-69939937 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 69865212 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 591 (P591L)
Ref Sequence ENSEMBL: ENSMUSP00000106199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049239] [ENSMUST00000110567] [ENSMUST00000110570] [ENSMUST00000171211]
AlphaFold Q8BPM2
Predicted Effect probably benign
Transcript: ENSMUST00000049239
AA Change: P591L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047812
Gene: ENSMUSG00000034761
AA Change: P591L

DomainStartEndE-ValueType
S_TKc 20 277 4.07e-88 SMART
low complexity region 389 396 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
CNH 512 827 4.57e-142 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110567
AA Change: P572L

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000106196
Gene: ENSMUSG00000034761
AA Change: P572L

DomainStartEndE-ValueType
S_TKc 20 277 4.07e-88 SMART
low complexity region 370 377 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
CNH 493 808 3.98e-142 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110570
AA Change: P591L

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106199
Gene: ENSMUSG00000034761
AA Change: P591L

DomainStartEndE-ValueType
S_TKc 20 277 4.07e-88 SMART
low complexity region 389 396 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
CNH 512 827 3.98e-142 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153550
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153712
Predicted Effect probably benign
Transcript: ENSMUST00000171211
AA Change: P524L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126006
Gene: ENSMUSG00000034761
AA Change: P524L

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 208 2e-32 PFAM
Pfam:Pkinase 1 210 6.2e-52 PFAM
low complexity region 322 329 N/A INTRINSIC
low complexity region 404 415 N/A INTRINSIC
CNH 445 760 4.57e-142 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222163
Meta Mutation Damage Score 0.0835 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (105/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family, that is highly similar to yeast SPS1/STE20 kinase. Yeast SPS1/STE20 functions near the beginning of the MAP kinase signal cascades that is essential for yeast pheromone response. This kinase was shown to activate Jun kinase in mammalian cells, which suggested a role in stress response. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are viable and phenotypically normal but show impaired canonical and noncanonical Wnt signaling in progenitor B lymphocytes. Mice homozygous for a gene trap exhibit hypoalgesia, increased serum IgG1 and an increased percentage of peripheral blood CD4+ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 64,210,658 (GRCm39) R190H probably benign Het
Abcc12 T A 8: 87,265,005 (GRCm39) I647F probably damaging Het
Acnat2 C A 4: 49,380,172 (GRCm39) W384L probably damaging Het
Acvr1 A G 2: 58,367,723 (GRCm39) L146P possibly damaging Het
Ankrd16 T A 2: 11,789,127 (GRCm39) M238K probably benign Het
Clmn A T 12: 104,763,353 (GRCm39) I91N probably damaging Het
Cog8 A T 8: 107,776,806 (GRCm39) L523H probably damaging Het
Cpxm2 T A 7: 131,661,476 (GRCm39) K437M probably benign Het
Dhx57 A T 17: 80,560,540 (GRCm39) V999E probably damaging Het
Dnpep T C 1: 75,285,874 (GRCm39) probably benign Het
Dok3 G A 13: 55,671,270 (GRCm39) R434W probably damaging Het
Dpysl5 C T 5: 30,941,687 (GRCm39) H275Y probably benign Het
Ednra A T 8: 78,394,012 (GRCm39) N361K probably damaging Het
Ei24 A T 9: 36,695,861 (GRCm39) S210R probably damaging Het
Erich3 T A 3: 154,470,441 (GRCm39) V158E unknown Het
Fam193a T A 5: 34,623,549 (GRCm39) V1379E possibly damaging Het
Fasn A G 11: 120,699,654 (GRCm39) V2304A probably damaging Het
Fcgbp A C 7: 27,785,769 (GRCm39) D402A probably benign Het
Fkbp14 T C 6: 54,562,930 (GRCm39) probably benign Het
Fnip1 G A 11: 54,406,382 (GRCm39) V1160I possibly damaging Het
Fsd2 T C 7: 81,202,712 (GRCm39) K289R probably null Het
Fuca2 A T 10: 13,381,651 (GRCm39) D188V probably damaging Het
Gfpt2 T C 11: 49,701,797 (GRCm39) V116A probably benign Het
Gm10770 T A 2: 150,020,816 (GRCm39) K234* probably null Het
Gm9887 A G 12: 69,418,763 (GRCm39) probably benign Het
Gtf3c2 A G 5: 31,316,577 (GRCm39) probably benign Het
H2-M10.3 T C 17: 36,677,528 (GRCm39) D250G probably damaging Het
Hapln4 G A 8: 70,537,142 (GRCm39) V26M possibly damaging Het
Hook3 G A 8: 26,528,057 (GRCm39) A611V probably damaging Het
Hr T C 14: 70,809,412 (GRCm39) L1141P probably damaging Het
Ifngr1 T C 10: 19,485,164 (GRCm39) S388P probably damaging Het
Itga3 T A 11: 94,952,793 (GRCm39) Q326L probably damaging Het
Itgb3 T A 11: 104,556,346 (GRCm39) I729N probably damaging Het
Kcnab2 A G 4: 152,486,403 (GRCm39) S132P probably damaging Het
Lama3 C T 18: 12,672,850 (GRCm39) A2481V probably damaging Het
Lama3 T C 18: 12,631,735 (GRCm39) probably benign Het
Lce1e A T 3: 92,615,178 (GRCm39) C56* probably null Het
Lmcd1 T C 6: 112,264,832 (GRCm39) probably benign Het
Lrrc14 T A 15: 76,597,562 (GRCm39) probably null Het
Lypd8l A T 11: 58,503,338 (GRCm39) probably null Het
Mapk13 C A 17: 28,995,284 (GRCm39) D168E probably damaging Het
Marf1 A C 16: 13,950,529 (GRCm39) H952Q possibly damaging Het
Megf6 T C 4: 154,338,738 (GRCm39) probably null Het
Mical3 T C 6: 121,010,748 (GRCm39) I411M probably damaging Het
Myo5a A T 9: 75,124,789 (GRCm39) K1781N probably damaging Het
N4bp2 T C 5: 65,965,473 (GRCm39) V1174A probably benign Het
Ncdn A T 4: 126,644,216 (GRCm39) L202Q probably damaging Het
Ncor1 T A 11: 62,283,464 (GRCm39) M408L possibly damaging Het
Nf1 T C 11: 79,300,235 (GRCm39) L249P probably damaging Het
Nlrp9b T A 7: 19,783,521 (GRCm39) probably null Het
Nxpe3 A T 16: 55,669,996 (GRCm39) Y370N probably damaging Het
P2rx2 T A 5: 110,489,434 (GRCm39) T167S probably benign Het
Pcdhb19 G T 18: 37,632,161 (GRCm39) R652L probably benign Het
Pcdhga12 T C 18: 37,901,334 (GRCm39) L722P probably benign Het
Pde6a A T 18: 61,378,663 (GRCm39) I329F probably damaging Het
Pdpr T A 8: 111,828,583 (GRCm39) S29T probably benign Het
Pfkfb3 T C 2: 11,491,123 (GRCm39) D173G probably benign Het
Plcd4 A G 1: 74,604,961 (GRCm39) probably null Het
Polr1g T A 7: 19,091,684 (GRCm39) Q141L probably damaging Het
Pou2f2 A G 7: 24,796,533 (GRCm39) probably benign Het
Ppp1r14c TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGG 10: 3,316,702 (GRCm39) probably benign Het
Ppp1r42 T C 1: 10,073,611 (GRCm39) probably benign Het
Ptpre C T 7: 135,270,861 (GRCm39) H346Y probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rab12 A T 17: 66,805,103 (GRCm39) Y142N probably damaging Het
Rai14 A C 15: 10,572,556 (GRCm39) M857R probably damaging Het
Ranbp2 A G 10: 58,328,243 (GRCm39) K2753R probably damaging Het
Rasa4 A T 5: 136,132,765 (GRCm39) K6* probably null Het
Rasgef1a A G 6: 118,066,100 (GRCm39) M438V probably benign Het
Recql T G 6: 142,304,732 (GRCm39) probably benign Het
Rftn2 A G 1: 55,211,198 (GRCm39) V425A probably benign Het
Ror1 A G 4: 100,267,001 (GRCm39) Y234C probably damaging Het
Sap30l T A 11: 57,696,880 (GRCm39) L70Q probably damaging Het
Scn4a T C 11: 106,210,828 (GRCm39) R1730G probably damaging Het
Serinc5 T G 13: 92,827,488 (GRCm39) I268R probably damaging Het
Sin3b G A 8: 73,471,576 (GRCm39) V432I possibly damaging Het
Slc30a6 T C 17: 74,719,649 (GRCm39) M203T possibly damaging Het
Soat1 T C 1: 156,259,898 (GRCm39) N481S probably damaging Het
Sos2 G A 12: 69,686,928 (GRCm39) T206I probably benign Het
Sp100 G T 1: 85,632,724 (GRCm39) A132S probably benign Het
Sp140l1 C T 1: 85,066,521 (GRCm39) probably benign Het
Spata31d1c T A 13: 65,183,604 (GRCm39) L382* probably null Het
Stard9 T A 2: 120,531,341 (GRCm39) W2533R probably benign Het
Tas2r126 A G 6: 42,412,324 (GRCm39) T286A probably benign Het
Tedc2 T A 17: 24,436,910 (GRCm39) K275M probably damaging Het
Ten1 A T 11: 116,109,057 (GRCm39) K242N probably benign Het
Thoc2l A T 5: 104,665,616 (GRCm39) D46V possibly damaging Het
Tial1 C T 7: 128,056,752 (GRCm39) V1I probably damaging Het
Tle2 G A 10: 81,424,725 (GRCm39) R649H possibly damaging Het
Tmem178 A G 17: 81,252,374 (GRCm39) D86G probably benign Het
Trim29 T A 9: 43,240,872 (GRCm39) D528E possibly damaging Het
Vmn2r61 A T 7: 41,950,132 (GRCm39) T851S probably benign Het
Vmn2r72 T A 7: 85,399,806 (GRCm39) Q414H possibly damaging Het
Yars1 A T 4: 129,083,675 (GRCm39) probably benign Het
Yipf4 A G 17: 74,801,087 (GRCm39) Q135R probably damaging Het
Zfp341 G A 2: 154,487,786 (GRCm39) probably benign Het
Zfp426 T C 9: 20,381,334 (GRCm39) Y536C probably damaging Het
Zp2 T G 7: 119,734,995 (GRCm39) Y430S probably damaging Het
Other mutations in Map4k5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Map4k5 APN 12 69,892,506 (GRCm39) missense probably damaging 1.00
IGL01013:Map4k5 APN 12 69,874,300 (GRCm39) splice site probably benign
IGL01309:Map4k5 APN 12 69,888,737 (GRCm39) missense probably benign 0.00
IGL02314:Map4k5 APN 12 69,865,213 (GRCm39) missense probably benign 0.05
IGL02612:Map4k5 APN 12 69,896,358 (GRCm39) missense possibly damaging 0.63
IGL02620:Map4k5 APN 12 69,939,476 (GRCm39) missense probably benign 0.05
IGL02749:Map4k5 APN 12 69,862,580 (GRCm39) missense probably benign 0.25
R0662:Map4k5 UTSW 12 69,859,927 (GRCm39) missense probably damaging 1.00
R0731:Map4k5 UTSW 12 69,921,038 (GRCm39) intron probably benign
R0828:Map4k5 UTSW 12 69,852,100 (GRCm39) missense probably damaging 0.98
R1026:Map4k5 UTSW 12 69,921,062 (GRCm39) missense possibly damaging 0.95
R1178:Map4k5 UTSW 12 69,863,152 (GRCm39) missense probably damaging 0.99
R1464:Map4k5 UTSW 12 69,852,124 (GRCm39) missense possibly damaging 0.89
R1464:Map4k5 UTSW 12 69,852,124 (GRCm39) missense possibly damaging 0.89
R1615:Map4k5 UTSW 12 69,891,187 (GRCm39) missense probably damaging 1.00
R1632:Map4k5 UTSW 12 69,874,821 (GRCm39) missense probably benign
R1652:Map4k5 UTSW 12 69,877,201 (GRCm39) critical splice donor site probably null
R1677:Map4k5 UTSW 12 69,852,082 (GRCm39) missense probably benign 0.01
R1835:Map4k5 UTSW 12 69,871,436 (GRCm39) missense probably damaging 1.00
R1895:Map4k5 UTSW 12 69,892,529 (GRCm39) missense probably damaging 1.00
R1946:Map4k5 UTSW 12 69,892,529 (GRCm39) missense probably damaging 1.00
R1968:Map4k5 UTSW 12 69,865,266 (GRCm39) missense probably damaging 0.99
R1971:Map4k5 UTSW 12 69,873,102 (GRCm39) missense possibly damaging 0.81
R1987:Map4k5 UTSW 12 69,889,686 (GRCm39) missense probably damaging 1.00
R2070:Map4k5 UTSW 12 69,863,111 (GRCm39) missense probably damaging 0.99
R2471:Map4k5 UTSW 12 69,903,620 (GRCm39) missense probably benign 0.30
R3417:Map4k5 UTSW 12 69,856,038 (GRCm39) missense probably damaging 1.00
R4133:Map4k5 UTSW 12 69,892,497 (GRCm39) missense probably damaging 1.00
R4331:Map4k5 UTSW 12 69,874,148 (GRCm39) missense probably benign 0.00
R4388:Map4k5 UTSW 12 69,892,583 (GRCm39) missense probably damaging 1.00
R4685:Map4k5 UTSW 12 69,858,140 (GRCm39) missense probably benign
R4760:Map4k5 UTSW 12 69,871,372 (GRCm39) missense possibly damaging 0.49
R4822:Map4k5 UTSW 12 69,888,758 (GRCm39) nonsense probably null
R4971:Map4k5 UTSW 12 69,899,493 (GRCm39) missense possibly damaging 0.60
R5038:Map4k5 UTSW 12 69,871,388 (GRCm39) missense probably damaging 1.00
R5055:Map4k5 UTSW 12 69,878,332 (GRCm39) missense probably benign
R5248:Map4k5 UTSW 12 69,888,755 (GRCm39) missense probably benign 0.36
R5428:Map4k5 UTSW 12 69,884,787 (GRCm39) missense possibly damaging 0.94
R5697:Map4k5 UTSW 12 69,877,210 (GRCm39) missense probably benign
R5757:Map4k5 UTSW 12 69,871,429 (GRCm39) missense probably damaging 1.00
R5955:Map4k5 UTSW 12 69,891,164 (GRCm39) missense probably damaging 1.00
R6258:Map4k5 UTSW 12 69,878,336 (GRCm39) missense probably benign 0.06
R6259:Map4k5 UTSW 12 69,899,514 (GRCm39) missense probably damaging 0.97
R6260:Map4k5 UTSW 12 69,878,336 (GRCm39) missense probably benign 0.06
R6796:Map4k5 UTSW 12 69,864,799 (GRCm39) missense probably benign 0.01
R6979:Map4k5 UTSW 12 69,869,622 (GRCm39) missense probably damaging 1.00
R7164:Map4k5 UTSW 12 69,877,210 (GRCm39) missense probably benign
R7184:Map4k5 UTSW 12 69,921,095 (GRCm39) missense probably benign 0.00
R7598:Map4k5 UTSW 12 69,871,412 (GRCm39) missense possibly damaging 0.75
R8395:Map4k5 UTSW 12 69,877,203 (GRCm39) missense probably null
R8445:Map4k5 UTSW 12 69,897,741 (GRCm39) missense probably damaging 1.00
R8757:Map4k5 UTSW 12 69,897,598 (GRCm39) critical splice donor site probably benign
R8827:Map4k5 UTSW 12 69,903,635 (GRCm39) missense possibly damaging 0.88
R8896:Map4k5 UTSW 12 69,870,275 (GRCm39) missense possibly damaging 0.94
R8898:Map4k5 UTSW 12 69,859,931 (GRCm39) missense possibly damaging 0.88
R9224:Map4k5 UTSW 12 69,939,467 (GRCm39) missense possibly damaging 0.61
R9563:Map4k5 UTSW 12 69,863,167 (GRCm39) missense probably benign 0.40
RF002:Map4k5 UTSW 12 69,903,630 (GRCm39) missense probably damaging 0.96
X0062:Map4k5 UTSW 12 69,871,381 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACCCTGGACTCTGACCTTATAG -3'
(R):5'- TACTGGACTCGCCACCTTAGAAG -3'

Sequencing Primer
(F):5'- TGTGAATTATTTGTAGTCTGGATGAC -3'
(R):5'- CCTGGAACTCACCATGTAGAGTTG -3'
Posted On 2016-03-17