Mutagenetix > Incidental Mutation

Incidental Mutation 'R4863:Pde6a'

374710

Institutional Source

Beutler Lab

Gene Symbol

Pde6a

Ensembl Gene

ENSMUSG00000024575

Gene Name

phosphodiesterase 6A, cGMP-specific, rod, alpha

Synonyms

Pdea

MMRRC Submission

042473-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4863 (G1)

Quality Score

145

Status

Validated

Chromosome

Chromosomal Location

61220482-61289924 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 61245592 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 329 (I329F)

Ref Sequence

ENSEMBL: ENSMUSP00000025468 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025468]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000025468
AA Change: I329F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000025468
Gene: ENSMUSG00000024575
AA Change: I329F

Domain	Start	End	E-Value	Type
GAF	73	232	1.36e-21	SMART
GAF	254	441	3.21e-23	SMART
low complexity region	478	495	N/A	INTRINSIC
Blast:HDc	496	540	3e-11	BLAST
HDc	556	734	6.95e-8	SMART
Blast:HDc	759	786	1e-8	BLAST
low complexity region	817	837	N/A	INTRINSIC
low complexity region	839	853	N/A	INTRINSIC

Meta Mutation Damage Score

0.3111

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

99% (105/106)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cyclic-GMP (cGMP)-specific phosphodiesterase 6A alpha subunit, expressed in cells of the retinal rod outer segment. The phosphodiesterase 6 holoenzyme is a heterotrimer composed of an alpha, beta, and two gamma subunits. cGMP is an important regulator of rod cell membrane current, and its dynamic concentration is established by phosphodiesterase 6A cGMP hydrolysis and guanylate cyclase cGMP synthesis. The protein is a subunit of a key phototransduction enzyme and participates in processes of transmission and amplification of the visual signal. Mutations in this gene have been identified as one cause of autosomal recessive retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have retinal degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210407C18Rik	A	T	11: 58,612,512		probably null	Het
4930578I06Rik	C	T	14: 63,973,209	R190H	probably benign	Het
A530032D15Rik	C	T	1: 85,088,800		probably benign	Het
Abcc12	T	A	8: 86,538,376	I647F	probably damaging	Het
Acnat2	C	A	4: 49,380,172	W384L	probably damaging	Het
Acvr1	A	G	2: 58,477,711	L146P	possibly damaging	Het
Ankrd16	T	A	2: 11,784,316	M238K	probably benign	Het
BC005561	A	T	5: 104,517,750	D46V	possibly damaging	Het
Cd3eap	T	A	7: 19,357,759	Q141L	probably damaging	Het
Clmn	A	T	12: 104,797,094	I91N	probably damaging	Het
Cog8	A	T	8: 107,050,174	L523H	probably damaging	Het
Cpxm2	T	A	7: 132,059,747	K437M	probably benign	Het
Dhx57	A	T	17: 80,253,111	V999E	probably damaging	Het
Dnpep	T	C	1: 75,309,230		probably benign	Het
Dok3	G	A	13: 55,523,457	R434W	probably damaging	Het
Dpysl5	C	T	5: 30,784,343	H275Y	probably benign	Het
Ednra	A	T	8: 77,667,383	N361K	probably damaging	Het
Ei24	A	T	9: 36,784,565	S210R	probably damaging	Het
Erich3	T	A	3: 154,764,804	V158E	unknown	Het
Fam193a	T	A	5: 34,466,205	V1379E	possibly damaging	Het
Fasn	A	G	11: 120,808,828	V2304A	probably damaging	Het
Fcgbp	A	C	7: 28,086,344	D402A	probably benign	Het
Fkbp14	T	C	6: 54,585,945		probably benign	Het
Fnip1	G	A	11: 54,515,556	V1160I	possibly damaging	Het
Fsd2	T	C	7: 81,552,964	K289R	probably null	Het
Fuca2	A	T	10: 13,505,907	D188V	probably damaging	Het
Gfpt2	T	C	11: 49,810,970	V116A	probably benign	Het
Gm10770	T	A	2: 150,178,896	K234*	probably null	Het
Gm9887	A	G	12: 69,371,989		probably benign	Het
Gtf3c2	A	G	5: 31,159,233		probably benign	Het
H2-M10.3	T	C	17: 36,366,636	D250G	probably damaging	Het
Hapln4	G	A	8: 70,084,492	V26M	possibly damaging	Het
Hook3	G	A	8: 26,038,029	A611V	probably damaging	Het
Hr	T	C	14: 70,571,972	L1141P	probably damaging	Het
Ifngr1	T	C	10: 19,609,416	S388P	probably damaging	Het
Itga3	T	A	11: 95,061,967	Q326L	probably damaging	Het
Itgb3	T	A	11: 104,665,520	I729N	probably damaging	Het
Kcnab2	A	G	4: 152,401,946	S132P	probably damaging	Het
Lama3	T	C	18: 12,498,678		probably benign	Het
Lama3	C	T	18: 12,539,793	A2481V	probably damaging	Het
Lce1e	A	T	3: 92,707,871	C56*	probably null	Het
Lmcd1	T	C	6: 112,287,871		probably benign	Het
Lrrc14	T	A	15: 76,713,362		probably null	Het
Map4k5	G	A	12: 69,818,438	P591L	probably benign	Het
Mapk13	C	A	17: 28,776,310	D168E	probably damaging	Het
Marf1	A	C	16: 14,132,665	H952Q	possibly damaging	Het
Megf6	T	C	4: 154,254,281		probably null	Het
Mical3	T	C	6: 121,033,787	I411M	probably damaging	Het
Myo5a	A	T	9: 75,217,507	K1781N	probably damaging	Het
N4bp2	T	C	5: 65,808,130	V1174A	probably benign	Het
Ncdn	A	T	4: 126,750,423	L202Q	probably damaging	Het
Ncor1	T	A	11: 62,392,638	M408L	possibly damaging	Het
Nf1	T	C	11: 79,409,409	L249P	probably damaging	Het
Nlrp9b	T	A	7: 20,049,596		probably null	Het
Nxpe3	A	T	16: 55,849,633	Y370N	probably damaging	Het
P2rx2	T	A	5: 110,341,568	T167S	probably benign	Het
Pcdhb19	G	T	18: 37,499,108	R652L	probably benign	Het
Pcdhga12	T	C	18: 37,768,281	L722P	probably benign	Het
Pdpr	T	A	8: 111,101,951	S29T	probably benign	Het
Pfkfb3	T	C	2: 11,486,312	D173G	probably benign	Het
Plcd4	A	G	1: 74,565,802		probably null	Het
Pou2f2	A	G	7: 25,097,108		probably benign	Het
Ppp1r14c	TGGCGGCGGCGGCGGCGG	TGGCGGCGGCGGCGG	10: 3,366,702		probably benign	Het
Ppp1r42	T	C	1: 10,003,386		probably benign	Het
Ptpre	C	T	7: 135,669,132	H346Y	probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rab12	A	T	17: 66,498,108	Y142N	probably damaging	Het
Rai14	A	C	15: 10,572,470	M857R	probably damaging	Het
Ranbp2	A	G	10: 58,492,421	K2753R	probably damaging	Het
Rasa4	A	T	5: 136,103,911	K6*	probably null	Het
Rasgef1a	A	G	6: 118,089,139	M438V	probably benign	Het
Recql	T	G	6: 142,359,006		probably benign	Het
Rftn2	A	G	1: 55,172,039	V425A	probably benign	Het
Ror1	A	G	4: 100,409,804	Y234C	probably damaging	Het
Sap30l	T	A	11: 57,806,054	L70Q	probably damaging	Het
Scn4a	T	C	11: 106,320,002	R1730G	probably damaging	Het
Serinc5	T	G	13: 92,690,980	I268R	probably damaging	Het
Sin3b	G	A	8: 72,744,948	V432I	possibly damaging	Het
Slc30a6	T	C	17: 74,412,654	M203T	possibly damaging	Het
Soat1	T	C	1: 156,432,328	N481S	probably damaging	Het
Sos2	G	A	12: 69,640,154	T206I	probably benign	Het
Sp100	G	T	1: 85,705,003	A132S	probably benign	Het
Spata31d1c	T	A	13: 65,035,790	L382*	probably null	Het
Stard9	T	A	2: 120,700,860	W2533R	probably benign	Het
Tas2r126	A	G	6: 42,435,390	T286A	probably benign	Het
Tedc2	T	A	17: 24,217,936	K275M	probably damaging	Het
Ten1	A	T	11: 116,218,231	K242N	probably benign	Het
Tial1	C	T	7: 128,455,028	V1I	probably damaging	Het
Tle2	G	A	10: 81,588,891	R649H	possibly damaging	Het
Tmem178	A	G	17: 80,944,945	D86G	probably benign	Het
Trim29	T	A	9: 43,329,575	D528E	possibly damaging	Het
Vmn2r61	A	T	7: 42,300,708	T851S	probably benign	Het
Vmn2r72	T	A	7: 85,750,598	Q414H	possibly damaging	Het
Yars	A	T	4: 129,189,882		probably benign	Het
Yipf4	A	G	17: 74,494,092	Q135R	probably damaging	Het
Zfp341	G	A	2: 154,645,866		probably benign	Het
Zfp426	T	C	9: 20,470,038	Y536C	probably damaging	Het
Zp2	T	G	7: 120,135,772	Y430S	probably damaging	Het

Other mutations in Pde6a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00583:Pde6a	APN	18	61257268	missense	probably damaging	1.00
IGL00896:Pde6a	APN	18	61220792	missense	possibly damaging	0.94
IGL01595:Pde6a	APN	18	61281528	missense	probably damaging	0.98
IGL02971:Pde6a	APN	18	61264255	missense	probably damaging	1.00
caffeinated	UTSW	18	61220606	start codon destroyed	probably null	0.95
R0219:Pde6a	UTSW	18	61285935	missense	possibly damaging	0.57
R0968:Pde6a	UTSW	18	61253738	missense	probably damaging	0.99
R1304:Pde6a	UTSW	18	61258293	missense	probably damaging	0.99
R1498:Pde6a	UTSW	18	61232860	missense	possibly damaging	0.73
R1542:Pde6a	UTSW	18	61257045	missense	possibly damaging	0.93
R1734:Pde6a	UTSW	18	61285965	missense	probably damaging	1.00
R1795:Pde6a	UTSW	18	61257212	missense	probably damaging	1.00
R2173:Pde6a	UTSW	18	61254382	missense	probably damaging	1.00
R2280:Pde6a	UTSW	18	61262434	missense	probably damaging	1.00
R2281:Pde6a	UTSW	18	61262434	missense	probably damaging	1.00
R3617:Pde6a	UTSW	18	61231503	splice site	probably benign
R4620:Pde6a	UTSW	18	61262492	missense	probably damaging	1.00
R4727:Pde6a	UTSW	18	61231489	missense	probably benign	0.02
R4904:Pde6a	UTSW	18	61265034	missense	probably benign	0.08
R4945:Pde6a	UTSW	18	61234718	missense	probably damaging	1.00
R4953:Pde6a	UTSW	18	61231362	nonsense	probably null
R5323:Pde6a	UTSW	18	61232911	missense	possibly damaging	0.81
R5496:Pde6a	UTSW	18	61253665	critical splice acceptor site	probably null
R5540:Pde6a	UTSW	18	61231366	missense	probably damaging	0.99
R6180:Pde6a	UTSW	18	61284092	splice site	probably null
R6366:Pde6a	UTSW	18	61265071	splice site	probably null
R6743:Pde6a	UTSW	18	61263986	missense	possibly damaging	0.48
R7161:Pde6a	UTSW	18	61281525	missense	probably benign	0.05
R7186:Pde6a	UTSW	18	61220606	start codon destroyed	probably null	0.95
R7197:Pde6a	UTSW	18	61258224	missense	probably damaging	0.96
R7296:Pde6a	UTSW	18	61258293	missense	probably damaging	0.99
R7487:Pde6a	UTSW	18	61249960	missense	probably damaging	1.00
R7734:Pde6a	UTSW	18	61232866	missense	probably benign	0.10
R7818:Pde6a	UTSW	18	61281509	splice site	probably null
R8104:Pde6a	UTSW	18	61231494	missense	probably damaging	0.99
R8135:Pde6a	UTSW	18	61285925	missense	probably damaging	0.98
R8213:Pde6a	UTSW	18	61220696	missense	possibly damaging	0.94
R8266:Pde6a	UTSW	18	61258213	missense	probably damaging	1.00
R8429:Pde6a	UTSW	18	61232844	missense	probably damaging	0.98
R8472:Pde6a	UTSW	18	61220946	missense	probably damaging	1.00
R8805:Pde6a	UTSW	18	61257033	missense	probably benign	0.13
R8882:Pde6a	UTSW	18	61245548	missense
R9002:Pde6a	UTSW	18	61285989	missense	probably damaging	1.00
R9015:Pde6a	UTSW	18	61263976	missense	probably damaging	0.99
R9338:Pde6a	UTSW	18	61221037	missense	probably damaging	1.00
R9353:Pde6a	UTSW	18	61257311	missense	probably damaging	1.00
R9446:Pde6a	UTSW	18	61285996	missense	probably benign	0.00
R9458:Pde6a	UTSW	18	61254406	missense	probably damaging	1.00
RF018:Pde6a	UTSW	18	61231403	missense	possibly damaging	0.84
X0064:Pde6a	UTSW	18	61264948	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- GCACGGGTAAACTTCCTGTG -3'
(R):5'- GCGGTGTCTTTAATCAAGCTC -3'

Sequencing Primer
(F):5'- GGGTAAACTTCCTGTGTTCTTTTTC -3'
(R):5'- AAGACTGTGTTGGAGGCA -3'

Posted On

2016-03-17