Incidental Mutation 'R4864:Dgkd'
ID374714
Institutional Source Beutler Lab
Gene Symbol Dgkd
Ensembl Gene ENSMUSG00000070738
Gene Namediacylglycerol kinase, delta
Synonymsdgkd-2, DGKdelta, AI841987, D330025K09
MMRRC Submission 042474-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.794) question?
Stock #R4864 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location87853287-87945180 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87916838 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 242 (N242I)
Ref Sequence ENSEMBL: ENSMUSP00000027517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027517]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027517
AA Change: N242I

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027517
Gene: ENSMUSG00000070738
AA Change: N242I

DomainStartEndE-ValueType
low complexity region 2 36 N/A INTRINSIC
PH 54 148 1.7e-16 SMART
C1 164 213 2.48e-15 SMART
low complexity region 221 232 N/A INTRINSIC
C1 236 286 8.56e-10 SMART
DAGKc 321 446 9.44e-62 SMART
low complexity region 691 710 N/A INTRINSIC
DAGKa 765 922 1.25e-98 SMART
low complexity region 1128 1139 N/A INTRINSIC
SAM 1148 1214 2.16e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191589
Meta Mutation Damage Score 0.9069 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic enzyme that phosphorylates diacylglycerol to produce phosphatidic acid. Diacylglycerol and phosphatidic acid are two lipids that act as second messengers in signaling cascades. Their cellular concentrations are regulated by the encoded protein, and so it is thought to play an important role in cellular signal transduction. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are born with open eyelids and reduced body size, develop respiratory distress and die within 24 hrs of birth. Half of mice homozygous for a hypomorphic gene trap allele exhibit abnormal epileptic discharges and seizureswhile 9% of aging homozygotes develop tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
Acp6 T C 3: 97,159,367 probably null Het
Adora3 T A 3: 105,907,815 Y148N probably damaging Het
Ahnak2 G A 12: 112,773,606 S538L probably damaging Het
Aox3 T G 1: 58,176,487 V1026G probably damaging Het
Ap3d1 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 10: 80,712,778 probably null Het
Arhgef37 G A 18: 61,494,925 A649V probably benign Het
Atp5a1 G A 18: 77,781,315 R413H possibly damaging Het
Bace1 A T 9: 45,854,811 I179F probably damaging Het
Brinp1 A G 4: 68,798,886 F242L probably damaging Het
Brk1 T C 6: 113,615,844 Y63H possibly damaging Het
Ccdc74a A G 16: 17,648,872 T148A probably benign Het
Cenpc1 T A 5: 86,045,321 L236F probably damaging Het
Col13a1 C T 10: 61,862,660 E541K unknown Het
Copg1 T A 6: 87,889,696 C44S probably damaging Het
D130043K22Rik A G 13: 24,863,612 E380G probably damaging Het
Dchs1 T C 7: 105,755,253 D2694G probably damaging Het
Dnah2 C T 11: 69,422,590 V4248I probably damaging Het
Dpy19l3 T A 7: 35,712,182 K376* probably null Het
Eef1d A G 15: 75,903,406 S135P possibly damaging Het
Epc2 T A 2: 49,537,165 S574T probably benign Het
Eps15 G A 4: 109,366,530 probably benign Het
Eps8 T C 6: 137,478,969 probably benign Het
Exoc5 A T 14: 49,052,382 V13E probably benign Het
Fbn1 A T 2: 125,372,397 C765S possibly damaging Het
Fbxo5 A T 10: 5,802,392 C74S probably benign Het
Fbxw9 T C 8: 85,065,901 S322P probably damaging Het
Fmo5 T A 3: 97,645,879 I381N probably damaging Het
Fmo6 T C 1: 162,924,395 D175G probably benign Het
Gm11127 T A 17: 36,058,361 probably benign Het
Gm340 G T 19: 41,585,364 A853S probably benign Het
Gm7361 A G 5: 26,262,010 probably null Het
Gm9961 G A 16: 11,903,035 probably benign Het
Golga7b T A 19: 42,266,966 probably null Het
Gorab T C 1: 163,386,398 E321G probably benign Het
Gpx1 T A 9: 108,339,395 V28E probably benign Het
Hist2h3c1 T C 3: 96,247,259 I125T probably damaging Het
Hk1 T C 10: 62,342,539 S8G probably benign Het
Iqsec1 C T 6: 90,664,056 R1026H probably damaging Het
Kdm4b A T 17: 56,353,091 Y86F probably benign Het
Kprp C T 3: 92,824,522 R407Q unknown Het
Lamb1 C T 12: 31,321,006 T1400M probably benign Het
Lrriq3 T A 3: 155,187,810 Y383N possibly damaging Het
Map3k21 T C 8: 125,927,555 I371T probably benign Het
Mllt1 A T 17: 56,905,819 F105I probably damaging Het
Nfatc2 A G 2: 168,536,392 M451T probably damaging Het
Nfkbiz A C 16: 55,818,424 N224K probably damaging Het
Nlrp4d A G 7: 10,381,161 V531A noncoding transcript Het
Noc3l A G 19: 38,789,637 Y778H probably benign Het
Nup98 C A 7: 102,153,196 A734S possibly damaging Het
Olfr1016 A G 2: 85,799,689 Y194H probably damaging Het
Olfr700 T C 7: 106,805,964 Y166C probably damaging Het
Olfr730 T A 14: 50,186,582 I212F probably damaging Het
Olfr824 T A 10: 130,126,887 R57* probably null Het
Pate4 A T 9: 35,608,239 C52S probably damaging Het
Pecr C A 1: 72,277,331 A72S probably benign Het
Pomt1 A G 2: 32,251,992 N578S probably benign Het
Ppm1a T C 12: 72,783,964 S88P probably benign Het
Ppm1l T A 3: 69,542,511 probably benign Het
Prdm13 A G 4: 21,685,543 S86P unknown Het
Prph2 T C 17: 46,910,922 S76P probably benign Het
Sarnp G A 10: 128,833,343 R23H probably damaging Het
Sept1 T C 7: 127,216,892 probably benign Het
Serpini1 T C 3: 75,613,174 I26T probably benign Het
Setdb2 A G 14: 59,409,266 I616T probably benign Het
Slc2a10 T C 2: 165,514,621 F67S probably benign Het
Slc38a6 T A 12: 73,343,650 probably null Het
Smg6 T C 11: 74,930,162 S420P possibly damaging Het
Srp72 T A 5: 76,984,162 H229Q probably benign Het
Ston2 A G 12: 91,648,674 V320A possibly damaging Het
Stx3 A T 19: 11,777,151 I269N possibly damaging Het
Tdg-ps A G 15: 82,516,642 noncoding transcript Het
Tecpr1 T A 5: 144,214,117 N291I probably benign Het
Tmem177 A G 1: 119,910,823 V42A probably benign Het
Trim26 T A 17: 36,857,994 probably benign Het
Ttc17 A G 2: 94,366,635 S456P probably benign Het
Tubgcp6 T C 15: 89,103,818 Y984C probably benign Het
Unc5cl A G 17: 48,459,844 E82G possibly damaging Het
Uncx T C 5: 139,544,120 S43P probably damaging Het
Vmn1r1 A G 1: 182,157,767 V111A probably benign Het
Vmn1r168 A G 7: 23,541,482 I255V probably damaging Het
Vwce A G 19: 10,650,636 T487A probably benign Het
Xaf1 A G 11: 72,306,856 probably benign Het
Zfp27 G T 7: 29,894,836 P568Q probably damaging Het
Zfp382 A T 7: 30,133,460 I179F possibly damaging Het
Other mutations in Dgkd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Dgkd APN 1 87880411 missense probably damaging 1.00
IGL01531:Dgkd APN 1 87880411 missense probably damaging 1.00
IGL01627:Dgkd APN 1 87880428 missense probably damaging 1.00
IGL01720:Dgkd APN 1 87936765 missense probably damaging 1.00
IGL01915:Dgkd APN 1 87926058 missense possibly damaging 0.86
IGL01941:Dgkd APN 1 87924559 missense probably damaging 0.99
IGL01951:Dgkd APN 1 87916916 missense probably damaging 1.00
IGL02244:Dgkd APN 1 87915141 missense probably benign 0.27
IGL02581:Dgkd APN 1 87918002 splice site probably benign
IGL02852:Dgkd APN 1 87935413 missense probably damaging 1.00
IGL02893:Dgkd APN 1 87915208 splice site probably benign
IGL03367:Dgkd APN 1 87940308 critical splice donor site probably null
R0014:Dgkd UTSW 1 87881881 missense probably damaging 1.00
R0016:Dgkd UTSW 1 87917952 missense probably benign 0.02
R0219:Dgkd UTSW 1 87938274 splice site probably benign
R0496:Dgkd UTSW 1 87936900 missense probably null 0.83
R0559:Dgkd UTSW 1 87915104 missense probably damaging 1.00
R0591:Dgkd UTSW 1 87915104 missense probably damaging 1.00
R1270:Dgkd UTSW 1 87934125 missense probably damaging 0.96
R1599:Dgkd UTSW 1 87881886 missense possibly damaging 0.58
R1658:Dgkd UTSW 1 87926268 missense probably damaging 1.00
R1745:Dgkd UTSW 1 87932044 critical splice donor site probably null
R1959:Dgkd UTSW 1 87929827 missense possibly damaging 0.47
R1960:Dgkd UTSW 1 87929827 missense possibly damaging 0.47
R2044:Dgkd UTSW 1 87927691 missense probably benign
R2148:Dgkd UTSW 1 87881921 missense probably damaging 1.00
R2232:Dgkd UTSW 1 87929742 missense probably benign 0.05
R2266:Dgkd UTSW 1 87927818 unclassified probably benign
R3774:Dgkd UTSW 1 87936300 missense probably damaging 1.00
R4004:Dgkd UTSW 1 87935423 missense possibly damaging 0.56
R4005:Dgkd UTSW 1 87935423 missense possibly damaging 0.56
R4133:Dgkd UTSW 1 87941501 critical splice donor site probably null
R4235:Dgkd UTSW 1 87931982 nonsense probably null
R4644:Dgkd UTSW 1 87936294 missense probably damaging 1.00
R4747:Dgkd UTSW 1 87934167 missense probably damaging 1.00
R5334:Dgkd UTSW 1 87938267 critical splice donor site probably null
R5365:Dgkd UTSW 1 87935416 missense probably damaging 1.00
R5495:Dgkd UTSW 1 87926872 missense probably damaging 1.00
R5514:Dgkd UTSW 1 87934110 missense probably damaging 1.00
R5729:Dgkd UTSW 1 87936332 nonsense probably null
R5766:Dgkd UTSW 1 87880449 nonsense probably null
R6133:Dgkd UTSW 1 87938240 missense possibly damaging 0.93
R6137:Dgkd UTSW 1 87936381 missense possibly damaging 0.48
R6198:Dgkd UTSW 1 87924208 missense probably damaging 1.00
R6297:Dgkd UTSW 1 87926144 missense possibly damaging 0.94
R6577:Dgkd UTSW 1 87940240 missense probably damaging 1.00
R6846:Dgkd UTSW 1 87925691 splice site probably null
R6905:Dgkd UTSW 1 87935375 missense probably damaging 1.00
R7369:Dgkd UTSW 1 87921622 missense probably damaging 1.00
R7763:Dgkd UTSW 1 87926949 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTCTCCTTCCCAGTAGGTG -3'
(R):5'- CTCTGGGGTAAACTCAGGAAGG -3'

Sequencing Primer
(F):5'- GTACCTCATAGGCCCTGCATG -3'
(R):5'- GAGAAGAACAGAGCCCCAAGC -3'
Posted On2016-03-17