Incidental Mutation 'R0280:Npepps'
ID37472
Institutional Source Beutler Lab
Gene Symbol Npepps
Ensembl Gene ENSMUSG00000001441
Gene Nameaminopeptidase puromycin sensitive
SynonymsMP100, Psa
MMRRC Submission 038502-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.839) question?
Stock #R0280 (G1)
Quality Score185
Status Validated
Chromosome11
Chromosomal Location97205842-97280638 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97241014 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 338 (N338S)
Ref Sequence ENSEMBL: ENSMUSP00000001480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001480] [ENSMUST00000154372] [ENSMUST00000154917] [ENSMUST00000167806] [ENSMUST00000172108]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001480
AA Change: N338S

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000001480
Gene: ENSMUSG00000001441
AA Change: N338S

DomainStartEndE-ValueType
low complexity region 3 45 N/A INTRINSIC
Pfam:Peptidase_M1 54 442 5.2e-155 PFAM
Pfam:ERAP1_C 579 892 7.9e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152820
Predicted Effect probably benign
Transcript: ENSMUST00000154372
Predicted Effect probably benign
Transcript: ENSMUST00000154917
SMART Domains Protein: ENSMUSP00000127631
Gene: ENSMUSG00000001441

DomainStartEndE-ValueType
low complexity region 3 45 N/A INTRINSIC
Pfam:Peptidase_M1 54 116 2e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000163164
AA Change: N114S
SMART Domains Protein: ENSMUSP00000129361
Gene: ENSMUSG00000001441
AA Change: N114S

DomainStartEndE-ValueType
Pfam:Peptidase_M1 2 145 2e-62 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000165216
AA Change: N293S
SMART Domains Protein: ENSMUSP00000128169
Gene: ENSMUSG00000001441
AA Change: N293S

DomainStartEndE-ValueType
low complexity region 4 35 N/A INTRINSIC
Pfam:Peptidase_M1 46 183 1.6e-28 PFAM
Pfam:Peptidase_M1 174 398 2.9e-100 PFAM
Pfam:ERAP1_C 535 848 2.9e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165489
Predicted Effect probably benign
Transcript: ENSMUST00000167806
AA Change: N338S

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130445
Gene: ENSMUSG00000001441
AA Change: N338S

DomainStartEndE-ValueType
low complexity region 3 45 N/A INTRINSIC
Pfam:Peptidase_M1 54 442 3e-153 PFAM
Pfam:Peptidase_MA_2 321 465 7.4e-24 PFAM
Pfam:ERAP1_C 579 632 5.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168743
SMART Domains Protein: ENSMUSP00000127127
Gene: ENSMUSG00000001441

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:Peptidase_M1 38 247 4.4e-58 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172108
AA Change: N338S

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127801
Gene: ENSMUSG00000001441
AA Change: N338S

DomainStartEndE-ValueType
low complexity region 3 45 N/A INTRINSIC
Pfam:Peptidase_M1 54 442 6e-153 PFAM
Pfam:Peptidase_MA_2 321 465 1.2e-23 PFAM
Pfam:ERAP1_C 579 859 5.7e-55 PFAM
low complexity region 868 886 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the puromycin-sensitive aminopeptidase, a zinc metallopeptidase which hydrolyzes amino acids from the N-terminus of its substrate. The protein has been localized to both the cytoplasm and to cellular membranes. This enzyme degrades enkaphalins in the brain, and studies in mouse suggest that it is involved in proteolytic events regulating the cell cycle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a gene-trapped mutation exhibit dwarfism, increased anxiety, decreased pain sensitivity, and infertility in both sexes. Females fail to produce the corpus luteum of pregnancy, while males fail to copulate and have impaired spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Adam18 C T 8: 24,674,054 G38R probably benign Het
Ankrd16 T G 2: 11,781,501 V187G probably damaging Het
AU019823 T C 9: 50,609,379 T123A probably damaging Het
Ccdc110 A T 8: 45,943,450 N793Y probably benign Het
Ccdc170 T C 10: 4,558,663 I629T possibly damaging Het
Clcn6 A G 4: 148,008,715 L836P probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crocc T C 4: 141,028,426 E1097G probably damaging Het
Csmd1 A T 8: 16,271,602 V494E probably damaging Het
Drg1 A T 11: 3,256,537 probably null Het
Dscam T C 16: 97,039,006 K134E possibly damaging Het
Dyrk1b T C 7: 28,184,312 Y198H probably damaging Het
Esr1 A G 10: 4,856,951 D289G probably benign Het
Esr1 G T 10: 4,939,289 V396F probably damaging Het
Evi5l T C 8: 4,193,133 V339A probably damaging Het
Fat4 A T 3: 38,890,816 Q1286L probably benign Het
Frem1 T C 4: 82,969,444 H1118R probably damaging Het
Fuk A T 8: 110,894,748 V188D probably damaging Het
Fut9 C T 4: 25,619,852 D321N probably benign Het
Gaa T G 11: 119,284,547 V917G probably damaging Het
Gm973 GCC GC 1: 59,544,680 probably null Het
Kidins220 A G 12: 25,010,141 T767A probably damaging Het
Kif7 A G 7: 79,698,823 S1257P probably benign Het
Ltn1 A G 16: 87,397,838 L1391P probably damaging Het
Mast3 A G 8: 70,783,795 Y681H probably damaging Het
Mast3 A G 8: 70,787,920 V291A possibly damaging Het
Metrn C T 17: 25,795,135 R239H probably benign Het
Mphosph10 C A 7: 64,376,703 K666N possibly damaging Het
Mtbp C T 15: 55,586,461 T433I probably benign Het
Mtmr2 A G 9: 13,799,249 K365E probably damaging Het
Nanog A G 6: 122,713,398 D229G probably damaging Het
Nphp4 T A 4: 152,551,936 probably benign Het
Olfr1279 T C 2: 111,307,072 F289S possibly damaging Het
Plcl2 A G 17: 50,607,034 E357G probably damaging Het
Polb A T 8: 22,640,392 Y173N probably damaging Het
R3hdm1 T A 1: 128,162,775 S74T probably benign Het
Raet1d T A 10: 22,370,883 C37S probably damaging Het
Reln G A 5: 22,227,513 probably benign Het
Rps6kc1 T C 1: 190,809,000 S369G probably damaging Het
Sgf29 A G 7: 126,671,571 E108G probably benign Het
Sh3tc1 A G 5: 35,706,017 L942P probably damaging Het
Slc22a27 A T 19: 7,896,822 L188* probably null Het
Slc9a3 T A 13: 74,159,424 I445N probably damaging Het
Sufu A T 19: 46,450,673 probably benign Het
Tomm40 G A 7: 19,713,751 T118I probably damaging Het
Ttc25 A T 11: 100,550,265 K107N probably damaging Het
Ttn C T 2: 76,740,479 R26690H probably damaging Het
Vmn2r16 A G 5: 109,340,139 I293V possibly damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Vsig8 A G 1: 172,561,538 D119G probably benign Het
Other mutations in Npepps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00826:Npepps APN 11 97236058 splice site probably benign
IGL00904:Npepps APN 11 97258306 missense probably damaging 0.99
IGL00925:Npepps APN 11 97280283 missense probably damaging 0.97
IGL01074:Npepps APN 11 97217811 missense probably damaging 0.98
IGL01869:Npepps APN 11 97236122 missense probably damaging 1.00
IGL01879:Npepps APN 11 97258340 missense possibly damaging 0.66
IGL02145:Npepps APN 11 97218502 splice site probably null
IGL02493:Npepps APN 11 97238159 missense probably damaging 1.00
IGL02561:Npepps APN 11 97229849 nonsense probably null
IGL02957:Npepps APN 11 97242652 missense probably damaging 1.00
IGL03008:Npepps APN 11 97238158 missense probably damaging 1.00
IGL03054:Npepps UTSW 11 97241788 intron probably benign
R0743:Npepps UTSW 11 97206058 utr 3 prime probably benign
R0838:Npepps UTSW 11 97267692 splice site probably benign
R1449:Npepps UTSW 11 97207154 missense probably benign 0.01
R1478:Npepps UTSW 11 97226847 missense probably benign 0.03
R1502:Npepps UTSW 11 97218575 missense possibly damaging 0.79
R1726:Npepps UTSW 11 97224669 missense probably damaging 1.00
R2413:Npepps UTSW 11 97240966 missense probably damaging 1.00
R3619:Npepps UTSW 11 97248265 missense possibly damaging 0.90
R4620:Npepps UTSW 11 97238244 missense probably damaging 1.00
R4782:Npepps UTSW 11 97226826 missense probably damaging 1.00
R4810:Npepps UTSW 11 97240933 missense probably damaging 1.00
R4998:Npepps UTSW 11 97206107 intron probably benign
R5086:Npepps UTSW 11 97217799 missense probably benign 0.01
R5289:Npepps UTSW 11 97240927 critical splice donor site probably null
R5740:Npepps UTSW 11 97236068 missense possibly damaging 0.85
R6004:Npepps UTSW 11 97223124 missense probably benign 0.03
R6181:Npepps UTSW 11 97242004 missense probably damaging 0.98
R6213:Npepps UTSW 11 97241997 nonsense probably null
R6244:Npepps UTSW 11 97213790 missense probably damaging 1.00
R6318:Npepps UTSW 11 97218548 missense probably damaging 0.98
R6478:Npepps UTSW 11 97258273 critical splice donor site probably null
R6724:Npepps UTSW 11 97206002 utr 3 prime probably benign
R6890:Npepps UTSW 11 97267644 nonsense probably null
R7035:Npepps UTSW 11 97223139 missense probably damaging 0.99
R7426:Npepps UTSW 11 97213156 missense probably benign 0.19
R7749:Npepps UTSW 11 97267628 missense probably benign
R7819:Npepps UTSW 11 97248269 missense probably damaging 1.00
R7885:Npepps UTSW 11 97218648 missense probably damaging 1.00
R7968:Npepps UTSW 11 97218648 missense probably damaging 1.00
X0021:Npepps UTSW 11 97238120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- gcagcaccagcacAGAGTATACAAG -3'
(R):5'- TGTCAGCACAGTACAAACATGTGGG -3'

Sequencing Primer
(F):5'- ATGTGCAGCAGGACATAGATGG -3'
(R):5'- GCATAAGTTCTGAAGCTGAGTC -3'
Posted On2013-05-23