Mutagenetix > Incidental Mutations

Incidental Mutation 'R0280:Kidins220'

37475

Institutional Source

Beutler Lab

Gene Symbol

Kidins220

Ensembl Gene

ENSMUSG00000036333

Gene Name

kinase D-interacting substrate 220

Synonyms

C330002I19Rik, 3110039L19Rik

MMRRC Submission

038502-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0280 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24974925-25063152 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 25010141 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 767 (T767A)

Ref Sequence

ENSEMBL: ENSMUSP00000152683 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066652] [ENSMUST00000220459] [ENSMUST00000222941]

AlphaFold

E9Q9B7

Predicted Effect

probably damaging
Transcript: ENSMUST00000066652
AA Change: T767A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000063999
Gene: ENSMUSG00000036333
AA Change: T767A

Domain	Start	End	E-Value	Type
ANK	37	66	1.11e-7	SMART
ANK	70	99	2.25e-3	SMART
ANK	103	132	4.78e-7	SMART
ANK	136	165	5.53e-3	SMART
ANK	169	198	2.52e-6	SMART
ANK	202	231	6.26e-2	SMART
ANK	235	264	1.22e-4	SMART
ANK	268	297	6.92e-4	SMART
ANK	301	330	1.57e-2	SMART
ANK	334	363	9.78e-4	SMART
ANK	367	398	4.6e0	SMART
Pfam:KAP_NTPase	440	953	1.2e-112	PFAM
low complexity region	1077	1092	N/A	INTRINSIC
low complexity region	1096	1107	N/A	INTRINSIC
low complexity region	1382	1396	N/A	INTRINSIC
low complexity region	1422	1452	N/A	INTRINSIC
low complexity region	1509	1520	N/A	INTRINSIC
low complexity region	1544	1555	N/A	INTRINSIC
low complexity region	1561	1567	N/A	INTRINSIC
low complexity region	1596	1609	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000220459
AA Change: T725A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

unknown
Transcript: ENSMUST00000222013
AA Change: T596A

Predicted Effect

probably damaging
Transcript: ENSMUST00000222941
AA Change: T767A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.4716

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.9%
20x: 94.6%

Validation Efficiency

96% (55/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is preferentially expressed in the nervous system where it controls neuronal cell survival, differentiation into exons and dendrites, and synaptic plasticity. The encoded protein interacts with membrane receptors, cytosolic signaling components, and cytoskeletal proteins, serving as a scaffold that mediates crosstalk between the neurotrophin pathway and several other intracellular signaling pathways. Aberrant expression of this gene is associated with the onset of various neuropsychiatric disorders and neurodegenerative diseases, including Alzheimer's disease. Naturally occurring mutations in this gene are associated with a syndrome characterized by spastic paraplegia, intellectual disability, nystagmus and obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for a knock-out allele exhibit decreased dendritic complexity in the barrel somatosensory cortex and dentate gyrus neurons. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
Adam18	C	T	8: 24,674,054	G38R	probably benign	Het
Ankrd16	T	G	2: 11,781,501	V187G	probably damaging	Het
AU019823	T	C	9: 50,609,379	T123A	probably damaging	Het
Ccdc110	A	T	8: 45,943,450	N793Y	probably benign	Het
Ccdc170	T	C	10: 4,558,663	I629T	possibly damaging	Het
Clcn6	A	G	4: 148,008,715	L836P	probably damaging	Het
Colgalt2	G	T	1: 152,508,561	A551S	possibly damaging	Het
Crocc	T	C	4: 141,028,426	E1097G	probably damaging	Het
Csmd1	A	T	8: 16,271,602	V494E	probably damaging	Het
Drg1	A	T	11: 3,256,537		probably null	Het
Dscam	T	C	16: 97,039,006	K134E	possibly damaging	Het
Dyrk1b	T	C	7: 28,184,312	Y198H	probably damaging	Het
Esr1	A	G	10: 4,856,951	D289G	probably benign	Het
Esr1	G	T	10: 4,939,289	V396F	probably damaging	Het
Evi5l	T	C	8: 4,193,133	V339A	probably damaging	Het
Fat4	A	T	3: 38,890,816	Q1286L	probably benign	Het
Frem1	T	C	4: 82,969,444	H1118R	probably damaging	Het
Fuk	A	T	8: 110,894,748	V188D	probably damaging	Het
Fut9	C	T	4: 25,619,852	D321N	probably benign	Het
Gaa	T	G	11: 119,284,547	V917G	probably damaging	Het
Gm973	GCC	GC	1: 59,544,680		probably null	Het
Kif7	A	G	7: 79,698,823	S1257P	probably benign	Het
Ltn1	A	G	16: 87,397,838	L1391P	probably damaging	Het
Mast3	A	G	8: 70,783,795	Y681H	probably damaging	Het
Mast3	A	G	8: 70,787,920	V291A	possibly damaging	Het
Metrn	C	T	17: 25,795,135	R239H	probably benign	Het
Mphosph10	C	A	7: 64,376,703	K666N	possibly damaging	Het
Mtbp	C	T	15: 55,586,461	T433I	probably benign	Het
Mtmr2	A	G	9: 13,799,249	K365E	probably damaging	Het
Nanog	A	G	6: 122,713,398	D229G	probably damaging	Het
Npepps	T	C	11: 97,241,014	N338S	possibly damaging	Het
Nphp4	T	A	4: 152,551,936		probably benign	Het
Olfr1279	T	C	2: 111,307,072	F289S	possibly damaging	Het
Plcl2	A	G	17: 50,607,034	E357G	probably damaging	Het
Polb	A	T	8: 22,640,392	Y173N	probably damaging	Het
R3hdm1	T	A	1: 128,162,775	S74T	probably benign	Het
Raet1d	T	A	10: 22,370,883	C37S	probably damaging	Het
Reln	G	A	5: 22,227,513		probably benign	Het
Rps6kc1	T	C	1: 190,809,000	S369G	probably damaging	Het
Sgf29	A	G	7: 126,671,571	E108G	probably benign	Het
Sh3tc1	A	G	5: 35,706,017	L942P	probably damaging	Het
Slc22a27	A	T	19: 7,896,822	L188*	probably null	Het
Slc9a3	T	A	13: 74,159,424	I445N	probably damaging	Het
Sufu	A	T	19: 46,450,673		probably benign	Het
Tomm40	G	A	7: 19,713,751	T118I	probably damaging	Het
Ttc25	A	T	11: 100,550,265	K107N	probably damaging	Het
Ttn	C	T	2: 76,740,479	R26690H	probably damaging	Het
Vmn2r16	A	G	5: 109,340,139	I293V	possibly damaging	Het
Vmn2r68	T	A	7: 85,233,249		probably benign	Het
Vmn2r68	C	G	7: 85,233,258		probably null	Het
Vsig8	A	G	1: 172,561,538	D119G	probably benign	Het

Other mutations in Kidins220

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Kidins220	APN	12	25038560	splice site	probably benign
IGL00959:Kidins220	APN	12	25051133	missense	possibly damaging	0.74
IGL00978:Kidins220	APN	12	25057474	missense	probably damaging	1.00
IGL01144:Kidins220	APN	12	25010926	missense	probably damaging	1.00
IGL01326:Kidins220	APN	12	25038499	missense	probably damaging	0.97
IGL01545:Kidins220	APN	12	25040460	missense	possibly damaging	0.66
IGL01802:Kidins220	APN	12	24995000	missense	probably damaging	1.00
IGL01875:Kidins220	APN	12	25057729	missense	probably benign	0.00
IGL02160:Kidins220	APN	12	25004111	missense	probably damaging	1.00
IGL02383:Kidins220	APN	12	24997333	splice site	probably benign
IGL02673:Kidins220	APN	12	24994992	missense	probably damaging	1.00
IGL02800:Kidins220	APN	12	25003093	missense	probably damaging	1.00
IGL03345:Kidins220	APN	12	25003045	missense	probably damaging	1.00
IGL03379:Kidins220	APN	12	25008448	missense	probably damaging	0.99
IGL03412:Kidins220	APN	12	24999345	missense	probably damaging	1.00
P0043:Kidins220	UTSW	12	25008156	missense	probably damaging	1.00
R0011:Kidins220	UTSW	12	24999352	missense	probably damaging	0.99
R0011:Kidins220	UTSW	12	24999352	missense	probably damaging	0.99
R0269:Kidins220	UTSW	12	25040512	missense	probably damaging	0.98
R0334:Kidins220	UTSW	12	25008069	missense	probably damaging	1.00
R1601:Kidins220	UTSW	12	25005088	missense	probably benign	0.35
R1778:Kidins220	UTSW	12	25013446	splice site	probably benign
R1808:Kidins220	UTSW	12	25003009	missense	probably benign	0.00
R1855:Kidins220	UTSW	12	25056591	missense	probably damaging	1.00
R1965:Kidins220	UTSW	12	24994906	missense	probably damaging	1.00
R1982:Kidins220	UTSW	12	25051194	missense	probably benign	0.01
R2069:Kidins220	UTSW	12	24987006	splice site	probably benign
R2101:Kidins220	UTSW	12	25057423	missense	probably damaging	1.00
R2124:Kidins220	UTSW	12	25041303	critical splice donor site	probably null
R2371:Kidins220	UTSW	12	25057324	missense	probably damaging	1.00
R2405:Kidins220	UTSW	12	25011509	missense	probably damaging	0.99
R3522:Kidins220	UTSW	12	24990758	missense	probably damaging	1.00
R3877:Kidins220	UTSW	12	25001565	splice site	probably benign
R3915:Kidins220	UTSW	12	25053958	missense	possibly damaging	0.93
R4023:Kidins220	UTSW	12	25057144	splice site	probably null
R4287:Kidins220	UTSW	12	25056846	missense	possibly damaging	0.81
R4476:Kidins220	UTSW	12	25011001	missense	probably damaging	1.00
R4495:Kidins220	UTSW	12	25038302	splice site	probably null
R4627:Kidins220	UTSW	12	25057042	missense	possibly damaging	0.89
R4807:Kidins220	UTSW	12	25057285	missense	probably damaging	1.00
R4899:Kidins220	UTSW	12	25013443	critical splice donor site	probably null
R4960:Kidins220	UTSW	12	24992260	nonsense	probably null
R5118:Kidins220	UTSW	12	24992297	missense	probably damaging	1.00
R5183:Kidins220	UTSW	12	25051126	missense	probably benign	0.17
R5238:Kidins220	UTSW	12	25003010	missense	probably benign	0.31
R5580:Kidins220	UTSW	12	25047897	missense	probably benign	0.00
R5707:Kidins220	UTSW	12	25013391	missense	probably damaging	1.00
R5813:Kidins220	UTSW	12	25057140	nonsense	probably null
R6131:Kidins220	UTSW	12	24992314	splice site	probably null
R6146:Kidins220	UTSW	12	25052813	missense	probably damaging	1.00
R6151:Kidins220	UTSW	12	25056909	missense	possibly damaging	0.65
R6160:Kidins220	UTSW	12	24997311	missense	probably damaging	1.00
R6187:Kidins220	UTSW	12	25051308	splice site	probably null
R6289:Kidins220	UTSW	12	25056616	missense	probably damaging	1.00
R6321:Kidins220	UTSW	12	25057534	missense	probably benign	0.09
R6450:Kidins220	UTSW	12	25057191	missense	probably benign
R6513:Kidins220	UTSW	12	25038435	missense	possibly damaging	0.94
R6652:Kidins220	UTSW	12	25010060	splice site	probably null
R6711:Kidins220	UTSW	12	24998751	missense	probably damaging	0.96
R6858:Kidins220	UTSW	12	25008543	missense	possibly damaging	0.85
R7102:Kidins220	UTSW	12	25057663	missense	probably benign	0.00
R7112:Kidins220	UTSW	12	25004019	missense	probably damaging	1.00
R7139:Kidins220	UTSW	12	24994821	missense	probably damaging	1.00
R7140:Kidins220	UTSW	12	25036624	missense	probably damaging	1.00
R7271:Kidins220	UTSW	12	25011571	missense	probably benign	0.21
R7361:Kidins220	UTSW	12	25057000	missense	probably benign	0.01
R7509:Kidins220	UTSW	12	24982361	missense	probably damaging	0.98
R7510:Kidins220	UTSW	12	24992269	missense	possibly damaging	0.88
R7783:Kidins220	UTSW	12	24988556	missense	probably damaging	1.00
R7796:Kidins220	UTSW	12	24982351	missense	probably damaging	0.96
R7831:Kidins220	UTSW	12	25061231	missense	possibly damaging	0.90
R8074:Kidins220	UTSW	12	25057716	missense	probably benign	0.29
R8214:Kidins220	UTSW	12	24994855	missense	probably damaging	1.00
R8304:Kidins220	UTSW	12	25057128	missense	probably benign	0.01
R8313:Kidins220	UTSW	12	25004111	missense	probably damaging	1.00
R8346:Kidins220	UTSW	12	25036534	missense	probably damaging	1.00
R8392:Kidins220	UTSW	12	24990728	missense	probably damaging	1.00
R8482:Kidins220	UTSW	12	25040528	missense	probably benign	0.00
R8722:Kidins220	UTSW	12	25001594	missense	probably benign
R8831:Kidins220	UTSW	12	25036455	missense	possibly damaging	0.70
R8960:Kidins220	UTSW	12	25056915	missense	probably benign	0.05
R9193:Kidins220	UTSW	12	24986967	missense	possibly damaging	0.79
R9267:Kidins220	UTSW	12	24988559	missense	probably benign	0.29
R9303:Kidins220	UTSW	12	25057111	missense	probably benign	0.36

Predicted Primers

PCR Primer
(F):5'- CAAGAGTAGTGCAGCCACCAGTAG -3'
(R):5'- GCCACACTTGTCACTCAGAGATGC -3'

Sequencing Primer
(F):5'- CCTGAGAATCAAGTGCTATCAGTC -3'
(R):5'- TCCTAAAGTGCCATCAGGCTG -3'

Posted On

2013-05-23