Incidental Mutation 'R4864:Map3k21'
ID374756
Institutional Source Beutler Lab
Gene Symbol Map3k21
Ensembl Gene ENSMUSG00000031853
Gene Namemitogen-activated protein kinase kinase kinase 21
SynonymsBC021891
MMRRC Submission 042474-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.475) question?
Stock #R4864 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location125910450-125947440 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125927555 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 371 (I371T)
Ref Sequence ENSEMBL: ENSMUSP00000034316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034316]
Predicted Effect probably benign
Transcript: ENSMUST00000034316
AA Change: I371T

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000034316
Gene: ENSMUSG00000031853
AA Change: I371T

DomainStartEndE-ValueType
SH3 27 87 1.1e-18 SMART
TyrKc 110 382 6.04e-82 SMART
coiled coil region 402 474 N/A INTRINSIC
low complexity region 478 492 N/A INTRINSIC
low complexity region 661 677 N/A INTRINSIC
low complexity region 740 758 N/A INTRINSIC
low complexity region 766 788 N/A INTRINSIC
Meta Mutation Damage Score 0.0974 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 99% (93/94)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
Acp6 T C 3: 97,159,367 probably null Het
Adora3 T A 3: 105,907,815 Y148N probably damaging Het
Ahnak2 G A 12: 112,773,606 S538L probably damaging Het
Aox3 T G 1: 58,176,487 V1026G probably damaging Het
Ap3d1 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 10: 80,712,778 probably null Het
Arhgef37 G A 18: 61,494,925 A649V probably benign Het
Atp5a1 G A 18: 77,781,315 R413H possibly damaging Het
Bace1 A T 9: 45,854,811 I179F probably damaging Het
Brinp1 A G 4: 68,798,886 F242L probably damaging Het
Brk1 T C 6: 113,615,844 Y63H possibly damaging Het
Ccdc74a A G 16: 17,648,872 T148A probably benign Het
Cenpc1 T A 5: 86,045,321 L236F probably damaging Het
Col13a1 C T 10: 61,862,660 E541K unknown Het
Copg1 T A 6: 87,889,696 C44S probably damaging Het
D130043K22Rik A G 13: 24,863,612 E380G probably damaging Het
Dchs1 T C 7: 105,755,253 D2694G probably damaging Het
Dgkd A T 1: 87,916,838 N242I possibly damaging Het
Dnah2 C T 11: 69,422,590 V4248I probably damaging Het
Dpy19l3 T A 7: 35,712,182 K376* probably null Het
Eef1d A G 15: 75,903,406 S135P possibly damaging Het
Epc2 T A 2: 49,537,165 S574T probably benign Het
Eps15 G A 4: 109,366,530 probably benign Het
Eps8 T C 6: 137,478,969 probably benign Het
Exoc5 A T 14: 49,052,382 V13E probably benign Het
Fbn1 A T 2: 125,372,397 C765S possibly damaging Het
Fbxo5 A T 10: 5,802,392 C74S probably benign Het
Fbxw9 T C 8: 85,065,901 S322P probably damaging Het
Fmo5 T A 3: 97,645,879 I381N probably damaging Het
Fmo6 T C 1: 162,924,395 D175G probably benign Het
Gm11127 T A 17: 36,058,361 probably benign Het
Gm340 G T 19: 41,585,364 A853S probably benign Het
Gm7361 A G 5: 26,262,010 probably null Het
Gm9961 G A 16: 11,903,035 probably benign Het
Golga7b T A 19: 42,266,966 probably null Het
Gorab T C 1: 163,386,398 E321G probably benign Het
Gpx1 T A 9: 108,339,395 V28E probably benign Het
Hist2h3c1 T C 3: 96,247,259 I125T probably damaging Het
Hk1 T C 10: 62,342,539 S8G probably benign Het
Iqsec1 C T 6: 90,664,056 R1026H probably damaging Het
Kdm4b A T 17: 56,353,091 Y86F probably benign Het
Kprp C T 3: 92,824,522 R407Q unknown Het
Lamb1 C T 12: 31,321,006 T1400M probably benign Het
Lrriq3 T A 3: 155,187,810 Y383N possibly damaging Het
Mllt1 A T 17: 56,905,819 F105I probably damaging Het
Nfatc2 A G 2: 168,536,392 M451T probably damaging Het
Nfkbiz A C 16: 55,818,424 N224K probably damaging Het
Nlrp4d A G 7: 10,381,161 V531A noncoding transcript Het
Noc3l A G 19: 38,789,637 Y778H probably benign Het
Nup98 C A 7: 102,153,196 A734S possibly damaging Het
Olfr1016 A G 2: 85,799,689 Y194H probably damaging Het
Olfr700 T C 7: 106,805,964 Y166C probably damaging Het
Olfr730 T A 14: 50,186,582 I212F probably damaging Het
Olfr824 T A 10: 130,126,887 R57* probably null Het
Pate4 A T 9: 35,608,239 C52S probably damaging Het
Pecr C A 1: 72,277,331 A72S probably benign Het
Pomt1 A G 2: 32,251,992 N578S probably benign Het
Ppm1a T C 12: 72,783,964 S88P probably benign Het
Ppm1l T A 3: 69,542,511 probably benign Het
Prdm13 A G 4: 21,685,543 S86P unknown Het
Prph2 T C 17: 46,910,922 S76P probably benign Het
Sarnp G A 10: 128,833,343 R23H probably damaging Het
Sept1 T C 7: 127,216,892 probably benign Het
Serpini1 T C 3: 75,613,174 I26T probably benign Het
Setdb2 A G 14: 59,409,266 I616T probably benign Het
Slc2a10 T C 2: 165,514,621 F67S probably benign Het
Slc38a6 T A 12: 73,343,650 probably null Het
Smg6 T C 11: 74,930,162 S420P possibly damaging Het
Srp72 T A 5: 76,984,162 H229Q probably benign Het
Ston2 A G 12: 91,648,674 V320A possibly damaging Het
Stx3 A T 19: 11,777,151 I269N possibly damaging Het
Tdg-ps A G 15: 82,516,642 noncoding transcript Het
Tecpr1 T A 5: 144,214,117 N291I probably benign Het
Tmem177 A G 1: 119,910,823 V42A probably benign Het
Trim26 T A 17: 36,857,994 probably benign Het
Ttc17 A G 2: 94,366,635 S456P probably benign Het
Tubgcp6 T C 15: 89,103,818 Y984C probably benign Het
Unc5cl A G 17: 48,459,844 E82G possibly damaging Het
Uncx T C 5: 139,544,120 S43P probably damaging Het
Vmn1r1 A G 1: 182,157,767 V111A probably benign Het
Vmn1r168 A G 7: 23,541,482 I255V probably damaging Het
Vwce A G 19: 10,650,636 T487A probably benign Het
Xaf1 A G 11: 72,306,856 probably benign Het
Zfp27 G T 7: 29,894,836 P568Q probably damaging Het
Zfp382 A T 7: 30,133,460 I179F possibly damaging Het
Other mutations in Map3k21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Map3k21 APN 8 125944673 missense possibly damaging 0.52
IGL01919:Map3k21 APN 8 125942132 missense probably damaging 0.97
IGL02065:Map3k21 APN 8 125941658 missense probably benign 0.01
IGL02123:Map3k21 APN 8 125926110 missense probably damaging 1.00
IGL02127:Map3k21 APN 8 125942147 missense probably benign
IGL02863:Map3k21 APN 8 125927541 missense probably benign 0.02
IGL03194:Map3k21 APN 8 125924062 missense possibly damaging 0.90
PIT4142001:Map3k21 UTSW 8 125937308 missense probably damaging 0.98
R0238:Map3k21 UTSW 8 125944970 missense possibly damaging 0.67
R0238:Map3k21 UTSW 8 125944970 missense possibly damaging 0.67
R0454:Map3k21 UTSW 8 125942119 missense probably benign
R0654:Map3k21 UTSW 8 125942020 missense probably benign 0.07
R1141:Map3k21 UTSW 8 125941732 missense probably benign 0.32
R1177:Map3k21 UTSW 8 125944838 missense probably benign 0.31
R1463:Map3k21 UTSW 8 125942137 missense probably benign 0.00
R1472:Map3k21 UTSW 8 125941678 missense probably benign
R1759:Map3k21 UTSW 8 125944780 missense probably benign
R1988:Map3k21 UTSW 8 125927555 missense probably benign 0.07
R2058:Map3k21 UTSW 8 125938722 missense probably benign 0.01
R2117:Map3k21 UTSW 8 125924042 missense probably benign 0.19
R2157:Map3k21 UTSW 8 125937266 missense probably benign
R2436:Map3k21 UTSW 8 125941615 nonsense probably null
R2507:Map3k21 UTSW 8 125939938 missense possibly damaging 0.73
R3125:Map3k21 UTSW 8 125941854 missense probably benign 0.26
R3746:Map3k21 UTSW 8 125935100 missense probably damaging 1.00
R4016:Map3k21 UTSW 8 125911185 missense probably damaging 1.00
R4647:Map3k21 UTSW 8 125942111 missense probably benign
R4648:Map3k21 UTSW 8 125942111 missense probably benign
R5642:Map3k21 UTSW 8 125938824 missense probably benign 0.17
R5694:Map3k21 UTSW 8 125944768 missense probably benign 0.04
R5950:Map3k21 UTSW 8 125941760 missense possibly damaging 0.93
R5982:Map3k21 UTSW 8 125911430 missense probably damaging 1.00
R6440:Map3k21 UTSW 8 125911137 missense probably damaging 1.00
R6550:Map3k21 UTSW 8 125937292 missense probably damaging 1.00
R6664:Map3k21 UTSW 8 125941871 missense probably benign 0.01
R6668:Map3k21 UTSW 8 125926113 missense possibly damaging 0.60
R6788:Map3k21 UTSW 8 125939866 missense probably benign 0.28
R7369:Map3k21 UTSW 8 125911116 missense possibly damaging 0.86
R7371:Map3k21 UTSW 8 125935065 missense probably damaging 0.99
R7381:Map3k21 UTSW 8 125944978 missense possibly damaging 0.83
R7388:Map3k21 UTSW 8 125927597 missense probably damaging 1.00
R7397:Map3k21 UTSW 8 125935116 missense probably damaging 1.00
R7497:Map3k21 UTSW 8 125927601 missense probably damaging 0.99
R7562:Map3k21 UTSW 8 125938800 missense probably damaging 1.00
R7564:Map3k21 UTSW 8 125927708 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GACCAAACATGCATGTGCG -3'
(R):5'- TGGTGAGACCACTCTCTTACC -3'

Sequencing Primer
(F):5'- AAACATGCATGTGCGGCCTG -3'
(R):5'- GGTGAGACCACTCTCTTACCTTCTC -3'
Posted On2016-03-17